EMAIL THIS PAGE TO A FRIEND

CCDC144B

coiled-coil domain containing 144B (pseudogene)

60 Gene Product Result for
UniProtKB ID: Q3MJ40, Q6P5Q3, Q8N200
Gene ID:
Mouse(241943) coiled-coil domain containing 144B
Rat(686106) coiled-coil domain containing 144B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2103649 Anti-CCDC144B antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182568 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182568 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182568 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178418 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178418 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178418 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182568 Rosetta Predictions human pricing
XM_001718183 Rosetta Predictions human pricing
XM_001066562 Rosetta Predictions rat pricing
NM_178418 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182568 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110326 predicted 2022
2 SASI_Hs01_00110327 predicted 550
3 SASI_Hs01_00110329 predicted 1697
4 SASI_Hs02_00370696 predicted 1152
5 SASI_Hs01_00110331 predicted 496
6 SASI_Hs01_00110333 predicted 1950
7 SASI_Hs01_00110334 predicted 1707
8 SASI_Hs02_00370697 predicted 1380
9 SASI_Hs01_00110335 predicted 1532
10 SASI_Hs02_00370698 predicted 1727
11 SASI_Hs01_00110328 predicted 1310
12 SASI_Hs01_00110330 predicted 704
13 SASI_Hs01_00110332 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718183 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00422066 predicted 499
2 SASI_Hs02_00422067 predicted 295
3 SASI_Hs02_00422068 predicted 249
4 SASI_Hs02_00422069 predicted 470
5 SASI_Hs02_00422070 predicted 472
6 SASI_Hs02_00422071 predicted 367
7 SASI_Hs02_00422072 predicted 589
8 SASI_Hs02_00422073 predicted 305
9 SASI_Hs02_00422074 predicted 406
10 SASI_Hs02_00422075 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066562 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317957 predicted 563
2 SASI_Rn02_00317958 predicted 847
3 SASI_Rn02_00317959 predicted 1104
4 SASI_Rn02_00317960 predicted 884
5 SASI_Rn02_00317961 predicted 1083
6 SASI_Rn02_00317962 predicted 747
7 SASI_Rn02_00317963 predicted 1068
8 SASI_Rn02_00317964 predicted 236
9 SASI_Rn02_00317965 predicted 812
10 SASI_Rn02_00317966 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070663 predicted 199
2 SASI_Mm02_00348890 predicted 962
3 SASI_Mm01_00070664 predicted 1125
4 SASI_Mm01_00070665 predicted 1142
5 SASI_Mm01_00070667 predicted 1075
6 SASI_Mm01_00070668 predicted 1203
7 SASI_Mm01_00070669 predicted 1087
8 SASI_Mm01_00070670 predicted 714
9 SASI_Mm02_00348891 predicted 1342
10 SASI_Mm01_00070671 predicted 1435
11 SASI_Mm01_00070666 predicted 543
12 SASI_Mm01_00070672 predicted 1589
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182568
CCDC144B MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 144B (pseudogene)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182568.1-1286s1c1
Sequence:CCGGCCATCCATACTATCATCCGTACTCGAGTACGGATGATAGTATGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182568.1-1011s1c1
Sequence:CCGGCAAGGCAAATTAGAGTGGAAACTCGAGTTTCCACTCTAATTTGCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182568.1-1822s1c1
Sequence:CCGGGCAATGATGATGATGGACTAACTCGAGTTAGTCCATCATCATCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182568.1-1570s1c1
Sequence:CCGGGCCTGAAACCTAAATTAGAAACTCGAGTTTCTAATTTAGGTTTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182568.1-1795s1c1
Sequence:CCGGGAACCCTAACTGATGGTACTACTCGAGTAGTACCATCAGTTAGGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182568.1-553s1c1
Sequence:CCGGCACCTGAAAGTCTTCCTCAAACTCGAGTTTGAGGAAGACTTTCAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182568
CCDC144B MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 144B (pseudogene)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182568.1-1286s1c1
Sequence:CCGGCCATCCATACTATCATCCGTACTCGAGTACGGATGATAGTATGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182568.1-1011s1c1
Sequence:CCGGCAAGGCAAATTAGAGTGGAAACTCGAGTTTCCACTCTAATTTGCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182568.1-1822s1c1
Sequence:CCGGGCAATGATGATGATGGACTAACTCGAGTTAGTCCATCATCATCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182568.1-1570s1c1
Sequence:CCGGGCCTGAAACCTAAATTAGAAACTCGAGTTTCTAATTTAGGTTTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182568.1-1795s1c1
Sequence:CCGGGAACCCTAACTGATGGTACTACTCGAGTAGTACCATCAGTTAGGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182568.1-553s1c1
Sequence:CCGGCACCTGAAAGTCTTCCTCAAACTCGAGTTTGAGGAAGACTTTCAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182568
CCDC144B MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 144B (pseudogene)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182568.1-1286s1c1
Sequence:CCGGCCATCCATACTATCATCCGTACTCGAGTACGGATGATAGTATGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167035    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182568.1-1011s1c1
Sequence:CCGGCAAGGCAAATTAGAGTGGAAACTCGAGTTTCCACTCTAATTTGCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182568.1-1822s1c1
Sequence:CCGGGCAATGATGATGATGGACTAACTCGAGTTAGTCCATCATCATCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182568.1-1570s1c1
Sequence:CCGGGCCTGAAACCTAAATTAGAAACTCGAGTTTCTAATTTAGGTTTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182568.1-1795s1c1
Sequence:CCGGGAACCCTAACTGATGGTACTACTCGAGTAGTACCATCAGTTAGGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182568.1-553s1c1
Sequence:CCGGCACCTGAAAGTCTTCCTCAAACTCGAGTTTGAGGAAGACTTTCAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178418
CCDC144B MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 144B (pseudogene)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178418.2-2173s1c1
Sequence:CCGGCCTGAGAACAGCTTGACCATACTCGAGTATGGTCAAGCTGTTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178418.2-1542s1c1
Sequence:CCGGCCACTTGTCCTAGAGACAGTACTCGAGTACTGTCTCTAGGACAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178418.2-1145s1c1
Sequence:CCGGCAGTATAAATGGGAAATCGAACTCGAGTTCGATTTCCCATTTATACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178418.2-283s1c1
Sequence:CCGGCCAGAATGCAATTCATTCATACTCGAGTATGAATGAATTGCATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178418.2-1229s1c1
Sequence:CCGGGCAGCGTATGAAGACAAGCTACTCGAGTAGCTTGTCTTCATACGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178418
CCDC144B MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 144B (pseudogene)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178418.2-2173s1c1
Sequence:CCGGCCTGAGAACAGCTTGACCATACTCGAGTATGGTCAAGCTGTTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178418.2-1542s1c1
Sequence:CCGGCCACTTGTCCTAGAGACAGTACTCGAGTACTGTCTCTAGGACAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178418.2-1145s1c1
Sequence:CCGGCAGTATAAATGGGAAATCGAACTCGAGTTCGATTTCCCATTTATACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178418.2-283s1c1
Sequence:CCGGCCAGAATGCAATTCATTCATACTCGAGTATGAATGAATTGCATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178418.2-1229s1c1
Sequence:CCGGGCAGCGTATGAAGACAAGCTACTCGAGTAGCTTGTCTTCATACGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178418
CCDC144B MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 144B (pseudogene)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104000    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178418.2-2173s1c1
Sequence:CCGGCCTGAGAACAGCTTGACCATACTCGAGTATGGTCAAGCTGTTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178418.2-1542s1c1
Sequence:CCGGCCACTTGTCCTAGAGACAGTACTCGAGTACTGTCTCTAGGACAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178418.2-1145s1c1
Sequence:CCGGCAGTATAAATGGGAAATCGAACTCGAGTTCGATTTCCCATTTATACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178418.2-283s1c1
Sequence:CCGGCCAGAATGCAATTCATTCATACTCGAGTATGAATGAATTGCATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178418.2-1229s1c1
Sequence:CCGGGCAGCGTATGAAGACAAGCTACTCGAGTAGCTTGTCTTCATACGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)