EMAIL THIS PAGE TO A FRIEND

CCDC144NL

coiled-coil domain containing 144 family, N-terminal like

178 Gene Product Result for
Species: Human CCDC144NL(339184)
UniProtKB ID: Q6NUI1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004306 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004306 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004306 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152311 MISSION® esiRNA esiRNA human CCDC144NL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004306 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004306 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053876 predicted 1224
2 SASI_Hs02_00304505 predicted 1219
3 SASI_Hs02_00304506 predicted 1225
4 SASI_Hs02_00304507 predicted 1171
5 SASI_Hs01_00053882 predicted 1151
6 SASI_Hs02_00304508 predicted 1219
7 SASI_Hs02_00304509 predicted 1218
8 SASI_Hs02_00304510 predicted 1215
9 SASI_Hs02_00304511 predicted 1140
10 SASI_Hs01_00053881 predicted 1184
11 SASI_Hs01_00053875 predicted 1106
12 SASI_Hs01_00053877 predicted 900
13 SASI_Hs01_00053878 predicted 959
14 SASI_Hs01_00053879 predicted 951
15 SASI_Hs01_00053880 predicted 949
16 SASI_Hs01_00053883 predicted 956
17 SASI_Hs01_00053884 predicted 1078
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004306
CCDC144NL MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 144 family, N-terminal like
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183793    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004306.1-848s1c1
Sequence:CCGGCCCTCTTTGATTCCTAGTATTCTCGAGAATACTAGGAATCAAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004306.1-684s1c1
Sequence:CCGGGCCTGGAGAGTATTGTCATCTCTCGAGAGATGACAATACTCTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004306.1-847s1c1
Sequence:CCGGGCCCTCTTTGATTCCTAGTATCTCGAGATACTAGGAATCAAAGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004306.1-705s1c1
Sequence:CCGGGCATGAGCAAAGAGTTCATCACTCGAGTGATGAACTCTTTGCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004306.1-469s1c1
Sequence:CCGGCAGCAACTAGTTCCTGAATATCTCGAGATATTCAGGAACTAGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004306.1-1226s1c1
Sequence:CCGGGCTCCCTTTAAGATTCAGTAACTCGAGTTACTGAATCTTAAAGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004306
CCDC144NL MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 144 family, N-terminal like
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183793    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004306.1-848s1c1
Sequence:CCGGCCCTCTTTGATTCCTAGTATTCTCGAGAATACTAGGAATCAAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004306.1-684s1c1
Sequence:CCGGGCCTGGAGAGTATTGTCATCTCTCGAGAGATGACAATACTCTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004306.1-847s1c1
Sequence:CCGGGCCCTCTTTGATTCCTAGTATCTCGAGATACTAGGAATCAAAGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004306.1-705s1c1
Sequence:CCGGGCATGAGCAAAGAGTTCATCACTCGAGTGATGAACTCTTTGCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004306.1-469s1c1
Sequence:CCGGCAGCAACTAGTTCCTGAATATCTCGAGATATTCAGGAACTAGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004306.1-1226s1c1
Sequence:CCGGGCTCCCTTTAAGATTCAGTAACTCGAGTTACTGAATCTTAAAGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004306
CCDC144NL MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 144 family, N-terminal like
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183793    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004306.1-848s1c1
Sequence:CCGGCCCTCTTTGATTCCTAGTATTCTCGAGAATACTAGGAATCAAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004306.1-684s1c1
Sequence:CCGGGCCTGGAGAGTATTGTCATCTCTCGAGAGATGACAATACTCTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004306.1-847s1c1
Sequence:CCGGGCCCTCTTTGATTCCTAGTATCTCGAGATACTAGGAATCAAAGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004306.1-705s1c1
Sequence:CCGGGCATGAGCAAAGAGTTCATCACTCGAGTGATGAACTCTTTGCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004306.1-469s1c1
Sequence:CCGGCAGCAACTAGTTCCTGAATATCTCGAGATATTCAGGAACTAGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004306.1-1226s1c1
Sequence:CCGGGCTCCCTTTAAGATTCAGTAACTCGAGTTACTGAATCTTAAAGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks