EMAIL THIS PAGE TO A FRIEND

CCDC146

coiled-coil domain containing 146

46 Gene Product Result for
UniProtKB ID: Q8IYE0, A8K8X6, Q9P223
Gene ID:
Mouse(75172) coiled-coil domain containing 146
Rat(499980) coiled-coil domain containing 146
Zebrafish(767671) coiled-coil domain containing 146
chicken(417723) coiled-coil domain containing 146
domestic cat(101088146) coiled-coil domain containing 146
cow(100140763) coiled-coil domain containing 146
Horse(100050045) coiled-coil domain containing 146
dog(610021) coiled-coil domain containing 146
naked mole-rat(101696448) coiled-coil domain containing 146
domestic guinea pig(100728803) coiled-coil domain containing 146
sheep(101118014) coiled-coil domain containing 146
Domestic Rabbit(100340142) coiled-coil domain containing 146
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020879 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020879 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020879 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU091181 MISSION® esiRNA esiRNA human CCDC146 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020879 Rosetta Predictions human pricing
NM_001025044 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020879 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063335 predicted 201
2 SASI_Hs02_00354178 predicted 2544
3 SASI_Hs01_00063336 predicted 1414
4 SASI_Hs01_00063337 predicted 2953
5 SASI_Hs01_00063338 predicted 400
6 SASI_Hs01_00063339 predicted 2971
7 SASI_Hs01_00063340 predicted 1312
8 SASI_Hs01_00063341 predicted 2958
9 SASI_Hs01_00063342 predicted 546
10 SASI_Hs02_00354179 predicted 2189
11 SASI_Hs01_00063333 predicted 2554
12 SASI_Hs01_00063334 predicted 2022
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025044 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071308 predicted 622
2 SASI_Rn01_00071309 predicted 1625
3 SASI_Rn01_00071311 predicted 301
4 SASI_Rn01_00071312 predicted 261
5 SASI_Rn01_00071313 predicted 2027
6 SASI_Rn02_00202973 predicted 1672
7 SASI_Rn01_00071314 predicted 3043
8 SASI_Rn02_00202974 predicted 396
9 SASI_Rn01_00071315 predicted 3024
10 SASI_Rn01_00071316 predicted 1150
11 SASI_Rn01_00071310 predicted 2571
12 SASI_Rn01_00071317 predicted 2685
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020879
CCDC146 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 146
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000116232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020879.1-3150s1c1
Sequence:CCGGCCCACCAACTACTATACCTTTCTCGAGAAAGGTATAGTAGTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020879.1-1019s1c1
Sequence:CCGGCGAGCCTTACTTGAAATCAAACTCGAGTTTGATTTCAAGTAAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020879.1-628s1c1
Sequence:CCGGGCCAGGAGAAATGGAGAAGAACTCGAGTTCTTCTCCATTTCTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020879.1-2622s1c1
Sequence:CCGGCCCTAACCATTGAACTCCAAACTCGAGTTTGGAGTTCAATGGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020879
CCDC146 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 146
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000116232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020879.1-3150s1c1
Sequence:CCGGCCCACCAACTACTATACCTTTCTCGAGAAAGGTATAGTAGTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020879.1-1019s1c1
Sequence:CCGGCGAGCCTTACTTGAAATCAAACTCGAGTTTGATTTCAAGTAAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020879.1-628s1c1
Sequence:CCGGGCCAGGAGAAATGGAGAAGAACTCGAGTTCTTCTCCATTTCTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020879.1-2622s1c1
Sequence:CCGGCCCTAACCATTGAACTCCAAACTCGAGTTTGGAGTTCAATGGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020879
CCDC146 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 146
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000116232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020879.1-3150s1c1
Sequence:CCGGCCCACCAACTACTATACCTTTCTCGAGAAAGGTATAGTAGTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020879.1-1019s1c1
Sequence:CCGGCGAGCCTTACTTGAAATCAAACTCGAGTTTGATTTCAAGTAAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020879.1-628s1c1
Sequence:CCGGGCCAGGAGAAATGGAGAAGAACTCGAGTTCTTCTCCATTTCTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020879.1-2622s1c1
Sequence:CCGGCCCTAACCATTGAACTCCAAACTCGAGTTTGGAGTTCAATGGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks