EMAIL THIS PAGE TO A FRIEND

CCDC147

coiled-coil domain containing 147

89 Gene Product Result for
Synonyms: C10orf80 bA127L20.4 bA127L20.5 bA554P13.1
UniProtKB ID: Q5T655, D3DRA6, Q8NA27
Gene ID:
Mouse(381229) coiled-coil domain containing 147
Rat(309467) coiled-coil domain containing 147
sheep(101116527) coiled-coil domain containing 147
domestic guinea pig(100719805) coiled-coil domain containing 147
naked mole-rat(101719222) coiled-coil domain containing 147
Zebrafish(561732) coiled-coil domain containing 147
chicken(423882) coiled-coil domain containing 147
domestic cat(101090804) coiled-coil domain containing 147
cow(536914) coiled-coil domain containing 147
Horse(100069546) coiled-coil domain containing 147
dog(477815) coiled-coil domain containing 147
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008723 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008723 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008723 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001163267 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163267 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163267 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140121 MISSION® esiRNA esiRNA human CCDC147 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008723 Rosetta Predictions human pricing
XM_001070481 Rosetta Predictions rat pricing
XM_219988 Rosetta Predictions rat pricing
XM_001481322 Rosetta Predictions mouse pricing
XM_355166 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126264 predicted 369
2 SASI_Hs01_00126265 predicted 1248
3 SASI_Hs01_00126266 predicted 1992
4 SASI_Hs02_00305541 predicted 549
5 SASI_Hs01_00126269 predicted 683
6 SASI_Hs02_00305542 predicted 1383
7 SASI_Hs02_00305543 predicted 408
8 SASI_Hs01_00126270 predicted 1890
9 SASI_Hs01_00126272 predicted 2774
10 SASI_Hs01_00126273 predicted 1972
11 SASI_Hs01_00126267 predicted 412
12 SASI_Hs01_00126268 predicted 1696
13 SASI_Hs01_00126271 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070481 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331788 predicted 1650
2 SASI_Rn02_00331789 predicted 1693
3 SASI_Rn02_00331790 predicted 2850
4 SASI_Rn02_00331791 predicted 603
5 SASI_Rn02_00331792 predicted 1593
6 SASI_Rn02_00331793 predicted 439
7 SASI_Rn02_00331794 predicted 2530
8 SASI_Rn02_00331795 predicted 1627
9 SASI_Rn02_00331796 predicted 2403
10 SASI_Rn02_00331797 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219988 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378885 predicted 599
2 SASI_Rn02_00378886 predicted 602
3 SASI_Rn02_00378887 predicted 436
4 SASI_Rn02_00378888 predicted 504
5 SASI_Rn02_00378889 predicted 196
6 SASI_Rn02_00378890 predicted 576
7 SASI_Rn02_00378891 predicted 1161
8 SASI_Rn02_00378892 predicted 328
9 SASI_Rn02_00378893 predicted 464
10 SASI_Rn02_00378894 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481322 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423706 predicted 346
2 SASI_Mm02_00423707 predicted 568
3 SASI_Mm02_00423708 predicted 439
4 SASI_Mm02_00423709 predicted 2662
5 SASI_Mm02_00423710 predicted 280
6 SASI_Mm02_00423711 predicted 320
7 SASI_Mm02_00423712 predicted 2704
8 SASI_Mm02_00423713 predicted 2487
9 SASI_Mm02_00423714 predicted 364
10 SASI_Mm02_00423715 predicted 2370
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355166 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425810 predicted 2707
2 SASI_Mm02_00425811 predicted 2747
3 SASI_Mm02_00425812 predicted 2741
4 SASI_Mm01_00253356 predicted 2758
5 SASI_Mm02_00425813 predicted 1579
6 SASI_Mm02_00425814 predicted 463
7 SASI_Mm01_00253349 predicted 689
8 SASI_Mm02_00425815 predicted 551
9 SASI_Mm02_00425816 predicted 1782
10 SASI_Mm01_00253352 predicted 1817
11 SASI_Mm01_00253348 predicted 237
12 SASI_Mm01_00253350 predicted 2825
13 SASI_Mm01_00253351 predicted 2771
14 SASI_Mm01_00253353 predicted 2815
15 SASI_Mm01_00253354 predicted 1955
16 SASI_Mm01_00253355 predicted 1869
17 SASI_Mm01_00253357 predicted 850
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008723
CCDC147 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 147
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167231    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008723.1-3107s1c1
Sequence:CCGGCCTCTCACCTTATTAACAATACTCGAGTATTGTTAATAAGGTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167200    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008723.1-3007s1c1
Sequence:CCGGCCCATTGATTGAAATGTACTACTCGAGTAGTACATTTCAATCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008723.1-566s21c1
Sequence:CCGGGCATAGCAACATCCGAGATTTCTCGAGAAATCTCGGATGTTGCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008723.1-1309s21c1
Sequence:CCGGACATGCTTAAGGCGGTCAATGCTCGAGCATTGACCGCCTTAAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008723.1-1764s21c1
Sequence:CCGGCACCTGGAACAGCAGCGAATACTCGAGTATTCGCTGCTGTTCCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008723.1-2918s21c1
Sequence:CCGGTTGTCTGGTTCACGTTGATATCTCGAGATATCAACGTGAACCAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008723.1-2610s21c1
Sequence:CCGGTACCTCGCTCAGAAACGTAAACTCGAGTTTACGTTTCTGAGCGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008723
CCDC147 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 147
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167231    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008723.1-3107s1c1
Sequence:CCGGCCTCTCACCTTATTAACAATACTCGAGTATTGTTAATAAGGTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167200    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008723.1-3007s1c1
Sequence:CCGGCCCATTGATTGAAATGTACTACTCGAGTAGTACATTTCAATCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008723.1-566s21c1
Sequence:CCGGGCATAGCAACATCCGAGATTTCTCGAGAAATCTCGGATGTTGCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008723.1-1309s21c1
Sequence:CCGGACATGCTTAAGGCGGTCAATGCTCGAGCATTGACCGCCTTAAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008723.1-1764s21c1
Sequence:CCGGCACCTGGAACAGCAGCGAATACTCGAGTATTCGCTGCTGTTCCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008723.1-2918s21c1
Sequence:CCGGTTGTCTGGTTCACGTTGATATCTCGAGATATCAACGTGAACCAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008723.1-2610s21c1
Sequence:CCGGTACCTCGCTCAGAAACGTAAACTCGAGTTTACGTTTCTGAGCGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008723
CCDC147 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 147
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167231    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008723.1-3107s1c1
Sequence:CCGGCCTCTCACCTTATTAACAATACTCGAGTATTGTTAATAAGGTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167200    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008723.1-3007s1c1
Sequence:CCGGCCCATTGATTGAAATGTACTACTCGAGTAGTACATTTCAATCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008723.1-566s21c1
Sequence:CCGGGCATAGCAACATCCGAGATTTCTCGAGAAATCTCGGATGTTGCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008723.1-1309s21c1
Sequence:CCGGACATGCTTAAGGCGGTCAATGCTCGAGCATTGACCGCCTTAAGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008723.1-1764s21c1
Sequence:CCGGCACCTGGAACAGCAGCGAATACTCGAGTATTCGCTGCTGTTCCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008723.1-2918s21c1
Sequence:CCGGTTGTCTGGTTCACGTTGATATCTCGAGATATCAACGTGAACCAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008723.1-2610s21c1
Sequence:CCGGTACCTCGCTCAGAAACGTAAACTCGAGTTTACGTTTCTGAGCGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163267
CCDC147 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 147
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163267.1-2671s21c1
Sequence:CCGGAGAAGTCCGTCCCTCGGTTTACTCGAGTAAACCGAGGGACGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163267.1-1549s21c1
Sequence:CCGGCCGAATCAGAGACGAAGTTAACTCGAGTTAACTTCGTCTCTGATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163267.1-188s21c1
Sequence:CCGGGGAGGTTCTCAGCGAACTTTCCTCGAGGAAAGTTCGCTGAGAACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163267.1-3049s21c1
Sequence:CCGGGGATGAAGCTTTGGGTATTAACTCGAGTTAATACCCAAAGCTTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163267.1-1499s21c1
Sequence:CCGGAGACATTAAAGTCCGAGAAATCTCGAGATTTCTCGGACTTTAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163267.1-2946s21c1
Sequence:CCGGGTGATTGCAGCTCTCTAATTACTCGAGTAATTAGAGAGCTGCAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163267
CCDC147 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 147
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163267.1-2671s21c1
Sequence:CCGGAGAAGTCCGTCCCTCGGTTTACTCGAGTAAACCGAGGGACGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163267.1-1549s21c1
Sequence:CCGGCCGAATCAGAGACGAAGTTAACTCGAGTTAACTTCGTCTCTGATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163267.1-188s21c1
Sequence:CCGGGGAGGTTCTCAGCGAACTTTCCTCGAGGAAAGTTCGCTGAGAACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163267.1-3049s21c1
Sequence:CCGGGGATGAAGCTTTGGGTATTAACTCGAGTTAATACCCAAAGCTTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163267.1-1499s21c1
Sequence:CCGGAGACATTAAAGTCCGAGAAATCTCGAGATTTCTCGGACTTTAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163267.1-2946s21c1
Sequence:CCGGGTGATTGCAGCTCTCTAATTACTCGAGTAATTAGAGAGCTGCAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163267
CCDC147 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 147
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163267.1-2671s21c1
Sequence:CCGGAGAAGTCCGTCCCTCGGTTTACTCGAGTAAACCGAGGGACGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163267.1-1549s21c1
Sequence:CCGGCCGAATCAGAGACGAAGTTAACTCGAGTTAACTTCGTCTCTGATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163267.1-188s21c1
Sequence:CCGGGGAGGTTCTCAGCGAACTTTCCTCGAGGAAAGTTCGCTGAGAACCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163267.1-3049s21c1
Sequence:CCGGGGATGAAGCTTTGGGTATTAACTCGAGTTAATACCCAAAGCTTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163267.1-1499s21c1
Sequence:CCGGAGACATTAAAGTCCGAGAAATCTCGAGATTTCTCGGACTTTAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163267.1-2946s21c1
Sequence:CCGGGTGATTGCAGCTCTCTAATTACTCGAGTAATTAGAGAGCTGCAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks