EMAIL THIS PAGE TO A FRIEND

CCDC148

coiled-coil domain containing 148

59 Gene Product Result for
Gene ID:
Mouse(227933) coiled-coil domain containing 148
Rat(311051) coiled-coil domain containing 148
chicken(424327) coiled-coil domain containing 148
cow(614176) coiled-coil domain containing 148
Horse(100059709) coiled-coil domain containing 148
domestic cat(101091801) coiled-coil domain containing 148
dog(478758) coiled-coil domain containing 148
naked mole-rat(101709656) coiled-coil domain containing 148
domestic guinea pig(100724148) coiled-coil domain containing 148
sheep(101112454) coiled-coil domain containing 148
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138803 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138803 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138803 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001178 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001178 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001178 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138803 Rosetta Predictions human pricing
NM_001107732 Rosetta Predictions rat pricing
XM_906580 Rosetta Predictions mouse pricing
XM_978242 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103427 predicted 863
2 SASI_Hs02_00363959 predicted 437
3 SASI_Hs01_00103428 predicted 1049
4 SASI_Hs01_00103429 predicted 1956
5 SASI_Hs02_00363960 predicted 1171
6 SASI_Hs01_00103430 predicted 328
7 SASI_Hs01_00103431 predicted 709
8 SASI_Hs01_00103433 predicted 718
9 SASI_Hs01_00103434 predicted 284
10 SASI_Hs02_00363961 predicted 727
11 SASI_Hs01_00103432 predicted 612
12 SASI_Hs01_00103435 predicted 1894
13 SASI_Hs01_00103436 predicted 1945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107732 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231725 predicted 1995
2 SASI_Rn02_00231726 predicted 461
3 SASI_Rn02_00231727 predicted 567
4 SASI_Rn02_00231728 predicted 771
5 SASI_Rn02_00231729 predicted 1181
6 SASI_Rn02_00231730 predicted 1059
7 SASI_Rn02_00231731 predicted 751
8 SASI_Rn02_00231732 predicted 357
9 SASI_Rn02_00231733 predicted 1810
10 SASI_Rn02_00231734 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_906580 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217305 predicted 660
2 SASI_Mm01_00217307 predicted 797
3 SASI_Mm01_00217308 predicted 882
4 SASI_Mm01_00217310 predicted 1001
5 SASI_Mm01_00217311 predicted 722
6 SASI_Mm02_00432612 predicted 881
7 SASI_Mm01_00217312 predicted 1602
8 SASI_Mm01_00217313 predicted 700
9 SASI_Mm01_00217314 predicted 636
10 SASI_Mm02_00432613 predicted 851
11 SASI_Mm01_00217306 predicted 967
12 SASI_Mm01_00217309 predicted 1730
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_978242 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00446559 predicted 596
2 SASI_Mm02_00446560 predicted 734
3 SASI_Mm02_00446561 predicted 815
4 SASI_Mm02_00446562 predicted 937
5 SASI_Mm02_00446563 predicted 657
6 SASI_Mm02_00446564 predicted 809
7 SASI_Mm02_00446565 predicted 630
8 SASI_Mm02_00446566 predicted 570
9 SASI_Mm02_00446567 predicted 779
10 SASI_Mm02_00446568 predicted 814
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138803
CCDC148 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 148
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138803.3-2313s21c1
Sequence:CCGGGAACTTAATTATGGCACATATCTCGAGATATGTGCCATAATTAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138803.3-2487s21c1
Sequence:CCGGATGGAAGCTTCATTATCATTACTCGAGTAATGATAATGAAGCTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138803.2-597s1c1
Sequence:CCGGGAGCAAGAGCTATCAGAACAACTCGAGTTGTTCTGATAGCTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138803.2-1740s1c1
Sequence:CCGGCTTAGGAAACAGGTTGCTGTTCTCGAGAACAGCAACCTGTTTCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138803.2-542s1c1
Sequence:CCGGCCTTCTCAATGAAGAGAACATCTCGAGATGTTCTCTTCATTGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138803.2-347s1c1
Sequence:CCGGCTATCAACAATTGCGTGCATTCTCGAGAATGCACGCAATTGTTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138803.2-1404s1c1
Sequence:CCGGGTAGCAAGACTGGAAATGGAACTCGAGTTCCATTTCCAGTCTTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138803.2-1143s1c1
Sequence:CCGGCCTCACAAATCTAGGCATGATCTCGAGATCATGCCTAGATTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138803.2-1776s1c1
Sequence:CCGGCCTGTTAGAATGATGTCAGATCTCGAGATCTGACATCATTCTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138803.2-1659s1c1
Sequence:CCGGGAAAGGCGTTTGATGGAGAAACTCGAGTTTCTCCATCAAACGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138803
CCDC148 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 148
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138803.3-2313s21c1
Sequence:CCGGGAACTTAATTATGGCACATATCTCGAGATATGTGCCATAATTAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138803.3-2487s21c1
Sequence:CCGGATGGAAGCTTCATTATCATTACTCGAGTAATGATAATGAAGCTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138803.2-597s1c1
Sequence:CCGGGAGCAAGAGCTATCAGAACAACTCGAGTTGTTCTGATAGCTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138803.2-1740s1c1
Sequence:CCGGCTTAGGAAACAGGTTGCTGTTCTCGAGAACAGCAACCTGTTTCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138803.2-542s1c1
Sequence:CCGGCCTTCTCAATGAAGAGAACATCTCGAGATGTTCTCTTCATTGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138803.2-347s1c1
Sequence:CCGGCTATCAACAATTGCGTGCATTCTCGAGAATGCACGCAATTGTTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138803.2-1404s1c1
Sequence:CCGGGTAGCAAGACTGGAAATGGAACTCGAGTTCCATTTCCAGTCTTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138803.2-1143s1c1
Sequence:CCGGCCTCACAAATCTAGGCATGATCTCGAGATCATGCCTAGATTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138803.2-1776s1c1
Sequence:CCGGCCTGTTAGAATGATGTCAGATCTCGAGATCTGACATCATTCTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138803.2-1659s1c1
Sequence:CCGGGAAAGGCGTTTGATGGAGAAACTCGAGTTTCTCCATCAAACGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138803
CCDC148 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 148
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138803.3-2313s21c1
Sequence:CCGGGAACTTAATTATGGCACATATCTCGAGATATGTGCCATAATTAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138803.3-2487s21c1
Sequence:CCGGATGGAAGCTTCATTATCATTACTCGAGTAATGATAATGAAGCTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138803.2-597s1c1
Sequence:CCGGGAGCAAGAGCTATCAGAACAACTCGAGTTGTTCTGATAGCTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138803.2-1740s1c1
Sequence:CCGGCTTAGGAAACAGGTTGCTGTTCTCGAGAACAGCAACCTGTTTCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138803.2-542s1c1
Sequence:CCGGCCTTCTCAATGAAGAGAACATCTCGAGATGTTCTCTTCATTGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138803.2-347s1c1
Sequence:CCGGCTATCAACAATTGCGTGCATTCTCGAGAATGCACGCAATTGTTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138803.2-1404s1c1
Sequence:CCGGGTAGCAAGACTGGAAATGGAACTCGAGTTCCATTTCCAGTCTTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138803.2-1143s1c1
Sequence:CCGGCCTCACAAATCTAGGCATGATCTCGAGATCATGCCTAGATTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138803.2-1776s1c1
Sequence:CCGGCCTGTTAGAATGATGTCAGATCTCGAGATCTGACATCATTCTAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138803.2-1659s1c1
Sequence:CCGGGAAAGGCGTTTGATGGAGAAACTCGAGTTTCTCCATCAAACGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001178
CCDC148 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 148
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000366445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001178.1-2518s21c1
Sequence:CCGGGTTTATGGCAAACCAATTATCCTCGAGGATAATTGGTTTGCCATAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001178.1-1187s21c1
Sequence:CCGGATTTGGTAGAACACGAGAAATCTCGAGATTTCTCGTGTTCTACCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001178.1-1924s21c1
Sequence:CCGGTCCGATCCTCGACTTCGATTTCTCGAGAAATCGAAGTCGAGGATCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001178.1-1099s21c1
Sequence:CCGGTTAGACCAGTATCCCGGAAATCTCGAGATTTCCGGGATACTGGTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001178.1-1957s21c1
Sequence:CCGGCGAGAAGCTGGACTCCATAAACTCGAGTTTATGGAGTCCAGCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001178.1-2075s21c1
Sequence:CCGGAGAACGAACACTGCGTGAATACTCGAGTATTCACGCAGTGTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001178.1-1314s21c1
Sequence:CCGGAGCCTGTGCAGCCCATGAAATCTCGAGATTTCATGGGCTGCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001178.1-952s21c1
Sequence:CCGGCCAGATCTGAAATCGTCAATCCTCGAGGATTGACGATTTCAGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001178
CCDC148 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 148
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000366445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001178.1-2518s21c1
Sequence:CCGGGTTTATGGCAAACCAATTATCCTCGAGGATAATTGGTTTGCCATAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001178.1-1187s21c1
Sequence:CCGGATTTGGTAGAACACGAGAAATCTCGAGATTTCTCGTGTTCTACCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001178.1-1924s21c1
Sequence:CCGGTCCGATCCTCGACTTCGATTTCTCGAGAAATCGAAGTCGAGGATCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001178.1-1099s21c1
Sequence:CCGGTTAGACCAGTATCCCGGAAATCTCGAGATTTCCGGGATACTGGTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001178.1-1957s21c1
Sequence:CCGGCGAGAAGCTGGACTCCATAAACTCGAGTTTATGGAGTCCAGCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001178.1-2075s21c1
Sequence:CCGGAGAACGAACACTGCGTGAATACTCGAGTATTCACGCAGTGTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001178.1-1314s21c1
Sequence:CCGGAGCCTGTGCAGCCCATGAAATCTCGAGATTTCATGGGCTGCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001178.1-952s21c1
Sequence:CCGGCCAGATCTGAAATCGTCAATCCTCGAGGATTGACGATTTCAGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001178
CCDC148 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 148
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000366445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001178.1-2518s21c1
Sequence:CCGGGTTTATGGCAAACCAATTATCCTCGAGGATAATTGGTTTGCCATAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001178.1-1187s21c1
Sequence:CCGGATTTGGTAGAACACGAGAAATCTCGAGATTTCTCGTGTTCTACCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001178.1-1924s21c1
Sequence:CCGGTCCGATCCTCGACTTCGATTTCTCGAGAAATCGAAGTCGAGGATCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001178.1-1099s21c1
Sequence:CCGGTTAGACCAGTATCCCGGAAATCTCGAGATTTCCGGGATACTGGTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001178.1-1957s21c1
Sequence:CCGGCGAGAAGCTGGACTCCATAAACTCGAGTTTATGGAGTCCAGCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001178.1-2075s21c1
Sequence:CCGGAGAACGAACACTGCGTGAATACTCGAGTATTCACGCAGTGTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001178.1-1314s21c1
Sequence:CCGGAGCCTGTGCAGCCCATGAAATCTCGAGATTTCATGGGCTGCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001178.1-952s21c1
Sequence:CCGGCCAGATCTGAAATCGTCAATCCTCGAGGATTGACGATTTCAGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks