EMAIL THIS PAGE TO A FRIEND

CCDC149

coiled-coil domain containing 149

82 Gene Product Result for
Gene ID:
Mouse(100503884) coiled-coil domain containing 149
chicken(100858889) coiled-coil domain containing 149
domestic cat(101083168) coiled-coil domain containing 149
dog(488854) coiled-coil domain containing 149
cow(613278) coiled-coil domain containing 149
sheep(101104578) coiled-coil domain containing 149
domestic guinea pig(100718480) coiled-coil domain containing 149
naked mole-rat(101701953) coiled-coil domain containing 149
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173463 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173463 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173463 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032821 MISSION® esiRNA esiRNA human CCDC149 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173463 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075164 predicted 286
2 SASI_Hs02_00368201 predicted 1007
3 SASI_Hs01_00075165 predicted 351
4 SASI_Hs01_00075167 predicted 330
5 SASI_Hs01_00075168 predicted 329
6 SASI_Hs01_00075170 predicted 327
7 SASI_Hs01_00075171 predicted 500
8 SASI_Hs02_00368202 predicted 841
9 SASI_Hs01_00075172 predicted 604
10 SASI_Hs01_00075173 predicted 273
11 SASI_Hs01_00075166 predicted 784
12 SASI_Hs01_00075169 predicted 335
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173463
CCDC149 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 149
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-545s1c1
Sequence:CCGGGAGCGAGCTAAGGAACAGATTCTCGAGAATCTGTTCCTTAGCTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-287s1c1
Sequence:CCGGCGAGAGCTGATTGATGGAGATCTCGAGATCTCCATCAATCAGCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-739s1c1
Sequence:CCGGCCTTCAAGAGAGATTAAAGCACTCGAGTGCTTTAATCTCTCTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-877s1c1
Sequence:CCGGCCTGTCTGCAAAGCAAGTTCACTCGAGTGAACTTGCTTTGCAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-954s1c1
Sequence:CCGGCTGACCTGAAATCTCTGGCAACTCGAGTTGCCAGAGATTTCAGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-775s1c1
Sequence:CCGGCAACCTCTTGAAATCAAACATCTCGAGATGTTTGATTTCAAGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-335s1c1
Sequence:CCGGCAGGCTAATCTTGCACAACTACTCGAGTAGTTGTGCAAGATTAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-982s1c1
Sequence:CCGGGTTGGAAACAATCCACGAGAACTCGAGTTCTCGTGGATTGTTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162402    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173463.2-4536s1c1
Sequence:CCGGCCCTTGATTTAGCCTTGTGTACTCGAGTACACAAGGCTAAATCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-757s1c1
Sequence:CCGGGCAACTCCATGAAGAGGTCAACTCGAGTTGACCTCTTCATGGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-358s1c1
Sequence:CCGGGAGAGATTCTCAGGACCGAAACTCGAGTTTCGGTCCTGAGAATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173463
CCDC149 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 149
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-545s1c1
Sequence:CCGGGAGCGAGCTAAGGAACAGATTCTCGAGAATCTGTTCCTTAGCTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-287s1c1
Sequence:CCGGCGAGAGCTGATTGATGGAGATCTCGAGATCTCCATCAATCAGCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-739s1c1
Sequence:CCGGCCTTCAAGAGAGATTAAAGCACTCGAGTGCTTTAATCTCTCTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-877s1c1
Sequence:CCGGCCTGTCTGCAAAGCAAGTTCACTCGAGTGAACTTGCTTTGCAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-954s1c1
Sequence:CCGGCTGACCTGAAATCTCTGGCAACTCGAGTTGCCAGAGATTTCAGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-775s1c1
Sequence:CCGGCAACCTCTTGAAATCAAACATCTCGAGATGTTTGATTTCAAGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-335s1c1
Sequence:CCGGCAGGCTAATCTTGCACAACTACTCGAGTAGTTGTGCAAGATTAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-982s1c1
Sequence:CCGGGTTGGAAACAATCCACGAGAACTCGAGTTCTCGTGGATTGTTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162402    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173463.2-4536s1c1
Sequence:CCGGCCCTTGATTTAGCCTTGTGTACTCGAGTACACAAGGCTAAATCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-757s1c1
Sequence:CCGGGCAACTCCATGAAGAGGTCAACTCGAGTTGACCTCTTCATGGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-358s1c1
Sequence:CCGGGAGAGATTCTCAGGACCGAAACTCGAGTTTCGGTCCTGAGAATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173463
CCDC149 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 149
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-545s1c1
Sequence:CCGGGAGCGAGCTAAGGAACAGATTCTCGAGAATCTGTTCCTTAGCTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-287s1c1
Sequence:CCGGCGAGAGCTGATTGATGGAGATCTCGAGATCTCCATCAATCAGCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-739s1c1
Sequence:CCGGCCTTCAAGAGAGATTAAAGCACTCGAGTGCTTTAATCTCTCTTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-877s1c1
Sequence:CCGGCCTGTCTGCAAAGCAAGTTCACTCGAGTGAACTTGCTTTGCAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-954s1c1
Sequence:CCGGCTGACCTGAAATCTCTGGCAACTCGAGTTGCCAGAGATTTCAGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-775s1c1
Sequence:CCGGCAACCTCTTGAAATCAAACATCTCGAGATGTTTGATTTCAAGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-335s1c1
Sequence:CCGGCAGGCTAATCTTGCACAACTACTCGAGTAGTTGTGCAAGATTAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-982s1c1
Sequence:CCGGGTTGGAAACAATCCACGAGAACTCGAGTTCTCGTGGATTGTTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162402    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173463.2-4536s1c1
Sequence:CCGGCCCTTGATTTAGCCTTGTGTACTCGAGTACACAAGGCTAAATCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-757s1c1
Sequence:CCGGGCAACTCCATGAAGAGGTCAACTCGAGTTGACCTCTTCATGGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173463.2-358s1c1
Sequence:CCGGGAGAGATTCTCAGGACCGAAACTCGAGTTTCGGTCCTGAGAATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks