EMAIL THIS PAGE TO A FRIEND

CCDC14

coiled-coil domain containing 14

73 Gene Product Result for
Gene ID:
Mouse(239839) coiled-coil domain containing 14
Rat(288054) coiled-coil domain containing 14
naked mole-rat(101705797) coiled-coil domain containing 14
domestic guinea pig(100727280) coiled-coil domain containing 14
sheep(101120380) coiled-coil domain containing 14
Domestic Rabbit(100354299) coiled-coil domain containing 14
Zebrafish(100330531) coiled-coil domain containing 14
cow(786080) coiled-coil domain containing 14
cow(788769) coiled-coil domain containing 14
domestic cat(101094287) coiled-coil domain containing 14
dog(608834) coiled-coil domain containing 14
chicken(424252) coiled-coil domain containing 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022757 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022757 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022757 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172824 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172824 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172824 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066951 MISSION® esiRNA esiRNA human CCDC14 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022757 Rosetta Predictions human pricing
XM_001071774 Rosetta Predictions rat pricing
XM_221392 Rosetta Predictions rat pricing
NM_172824 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022757 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173826 predicted 543
2 SASI_Hs02_00356016 predicted 2447
3 SASI_Hs01_00173828 predicted 1341
4 SASI_Hs02_00356017 predicted 865
5 SASI_Hs01_00173831 predicted 1971
6 SASI_Hs01_00173832 predicted 2797
7 SASI_Hs02_00356018 predicted 1585
8 SASI_Hs01_00173833 predicted 972
9 SASI_Hs02_00356019 predicted 2622
10 SASI_Hs02_00356020 predicted 2681
11 SASI_Hs01_00173827 predicted 6070
12 SASI_Hs01_00173829 predicted 4901
13 SASI_Hs01_00173830 predicted 5196
14 SASI_Hs01_00173834 predicted 5899
15 SASI_Hs01_00173835 predicted 5477
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071774 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00336420 predicted 261
2 SASI_Rn02_00336421 predicted 864
3 SASI_Rn02_00336422 predicted 945
4 SASI_Rn02_00336423 predicted 851
5 SASI_Rn02_00336424 predicted 2104
6 SASI_Rn02_00336425 predicted 1450
7 SASI_Rn02_00336426 predicted 889
8 SASI_Rn02_00336427 predicted 1718
9 SASI_Rn02_00336428 predicted 1159
10 SASI_Rn02_00336429 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221392 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380082 predicted 2100
2 SASI_Rn02_00380083 predicted 262
3 SASI_Rn02_00380084 predicted 860
4 SASI_Rn02_00380085 predicted 942
5 SASI_Rn02_00380086 predicted 786
6 SASI_Rn02_00380087 predicted 318
7 SASI_Rn02_00380088 predicted 892
8 SASI_Rn02_00380089 predicted 312
9 SASI_Rn02_00380090 predicted 407
10 SASI_Rn02_00380091 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172824 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344750 predicted 1893
2 SASI_Mm01_00101067 predicted 559
3 SASI_Mm02_00344751 predicted 2508
4 SASI_Mm02_00344752 predicted 2466
5 SASI_Mm02_00344753 predicted 2272
6 SASI_Mm01_00101069 predicted 433
7 SASI_Mm02_00344754 predicted 2301
8 SASI_Mm01_00101072 predicted 1358
9 SASI_Mm01_00101074 predicted 551
10 SASI_Mm01_00101073 predicted 408
11 SASI_Mm01_00101066 predicted 1473
12 SASI_Mm01_00101068 predicted 1490
13 SASI_Mm01_00101070 predicted 1340
14 SASI_Mm01_00101071 predicted 583
15 SASI_Mm01_00101075 predicted 1117
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022757
CCDC14 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 14
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022757.3-5187s1c1
Sequence:CCGGGCCACAAGTGAAAGAAGGGATCTCGAGATCCCTTCTTTCACTTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135638    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022757.3-7317s1c1
Sequence:CCGGGCCAGTGTTGTTGGTGAAATACTCGAGTATTTCACCAACAACACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022757.3-6618s1c1
Sequence:CCGGGAGGAACAAACTGCATGTCATCTCGAGATGACATGCAGTTTGTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022757.3-6141s1c1
Sequence:CCGGGAAACCATAGAGCCAGACAAACTCGAGTTTGTCTGGCTCTATGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022757.3-5447s1c1
Sequence:CCGGGCAACCATTAAGAAGTGAGAACTCGAGTTCTCACTTCTTAATGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022757.3-6813s1c1
Sequence:CCGGGCTAGACTCCAGAAGTCTTTACTCGAGTAAAGACTTCTGGAGTCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138592    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022757.3-7773s1c1
Sequence:CCGGCCTTCATGTAAGCAGCACGTTCTCGAGAACGTGCTGCTTACATGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022757.3-6641s1c1
Sequence:CCGGCCCATCAGGTTGTCTTAGCAACTCGAGTTGCTAAGACAACCTGATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022757.4-566s21c1
Sequence:CCGGAGAATGTATTCACCCATAATACTCGAGTATTATGGGTGAATACATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022757.4-3111s21c1
Sequence:CCGGAGATGTATCTGCTGGATTAAGCTCGAGCTTAATCCAGCAGATACATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022757.4-1576s21c1
Sequence:CCGGTCAATTGGAGGAGTCACTAAACTCGAGTTTAGTGACTCCTCCAATTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022757.4-2086s21c1
Sequence:CCGGAGAGCCACTTTCTACAATTAACTCGAGTTAATTGTAGAAAGTGGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022757.4-1867s21c1
Sequence:CCGGGACTCGACTAAGAGAATTAACCTCGAGGTTAATTCTCTTAGTCGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022757
CCDC14 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 14
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022757.3-5187s1c1
Sequence:CCGGGCCACAAGTGAAAGAAGGGATCTCGAGATCCCTTCTTTCACTTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135638    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022757.3-7317s1c1
Sequence:CCGGGCCAGTGTTGTTGGTGAAATACTCGAGTATTTCACCAACAACACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022757.3-6618s1c1
Sequence:CCGGGAGGAACAAACTGCATGTCATCTCGAGATGACATGCAGTTTGTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022757.3-6141s1c1
Sequence:CCGGGAAACCATAGAGCCAGACAAACTCGAGTTTGTCTGGCTCTATGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022757.3-5447s1c1
Sequence:CCGGGCAACCATTAAGAAGTGAGAACTCGAGTTCTCACTTCTTAATGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022757.3-6813s1c1
Sequence:CCGGGCTAGACTCCAGAAGTCTTTACTCGAGTAAAGACTTCTGGAGTCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138592    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022757.3-7773s1c1
Sequence:CCGGCCTTCATGTAAGCAGCACGTTCTCGAGAACGTGCTGCTTACATGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022757.3-6641s1c1
Sequence:CCGGCCCATCAGGTTGTCTTAGCAACTCGAGTTGCTAAGACAACCTGATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022757.4-566s21c1
Sequence:CCGGAGAATGTATTCACCCATAATACTCGAGTATTATGGGTGAATACATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022757.4-3111s21c1
Sequence:CCGGAGATGTATCTGCTGGATTAAGCTCGAGCTTAATCCAGCAGATACATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022757.4-1576s21c1
Sequence:CCGGTCAATTGGAGGAGTCACTAAACTCGAGTTTAGTGACTCCTCCAATTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022757.4-2086s21c1
Sequence:CCGGAGAGCCACTTTCTACAATTAACTCGAGTTAATTGTAGAAAGTGGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022757.4-1867s21c1
Sequence:CCGGGACTCGACTAAGAGAATTAACCTCGAGGTTAATTCTCTTAGTCGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022757
CCDC14 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 14
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022757.3-5187s1c1
Sequence:CCGGGCCACAAGTGAAAGAAGGGATCTCGAGATCCCTTCTTTCACTTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135638    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022757.3-7317s1c1
Sequence:CCGGGCCAGTGTTGTTGGTGAAATACTCGAGTATTTCACCAACAACACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022757.3-6618s1c1
Sequence:CCGGGAGGAACAAACTGCATGTCATCTCGAGATGACATGCAGTTTGTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022757.3-6141s1c1
Sequence:CCGGGAAACCATAGAGCCAGACAAACTCGAGTTTGTCTGGCTCTATGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022757.3-5447s1c1
Sequence:CCGGGCAACCATTAAGAAGTGAGAACTCGAGTTCTCACTTCTTAATGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022757.3-6813s1c1
Sequence:CCGGGCTAGACTCCAGAAGTCTTTACTCGAGTAAAGACTTCTGGAGTCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138592    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022757.3-7773s1c1
Sequence:CCGGCCTTCATGTAAGCAGCACGTTCTCGAGAACGTGCTGCTTACATGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022757.3-6641s1c1
Sequence:CCGGCCCATCAGGTTGTCTTAGCAACTCGAGTTGCTAAGACAACCTGATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022757.4-566s21c1
Sequence:CCGGAGAATGTATTCACCCATAATACTCGAGTATTATGGGTGAATACATTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022757.4-3111s21c1
Sequence:CCGGAGATGTATCTGCTGGATTAAGCTCGAGCTTAATCCAGCAGATACATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022757.4-1576s21c1
Sequence:CCGGTCAATTGGAGGAGTCACTAAACTCGAGTTTAGTGACTCCTCCAATTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022757.4-2086s21c1
Sequence:CCGGAGAGCCACTTTCTACAATTAACTCGAGTTAATTGTAGAAAGTGGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022757.4-1867s21c1
Sequence:CCGGGACTCGACTAAGAGAATTAACCTCGAGGTTAATTCTCTTAGTCGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172824
CCDC14 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 14
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172824.1-978s1c1
Sequence:CCGGCCAAACACACACGTCTCTGTTCTCGAGAACAGAGACGTGTGTGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172824.1-2576s1c1
Sequence:CCGGGCAAGTATCTTGCCATCTCATCTCGAGATGAGATGGCAAGATACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172824.1-909s1c1
Sequence:CCGGGCTGGATCTTACGAGTTGTATCTCGAGATACAACTCGTAAGATCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172824.1-910s1c1
Sequence:CCGGCTGGATCTTACGAGTTGTATTCTCGAGAATACAACTCGTAAGATCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172824.1-145s1c1
Sequence:CCGGCCTGGAGCTAAGTTACCAAATCTCGAGATTTGGTAACTTAGCTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183324    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172824.1-2787s1c1
Sequence:CCGGGCCTGGTATTTAAAGGAATAACTCGAGTTATTCCTTTAAATACCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172824
CCDC14 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 14
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172824.1-978s1c1
Sequence:CCGGCCAAACACACACGTCTCTGTTCTCGAGAACAGAGACGTGTGTGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172824.1-2576s1c1
Sequence:CCGGGCAAGTATCTTGCCATCTCATCTCGAGATGAGATGGCAAGATACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172824.1-909s1c1
Sequence:CCGGGCTGGATCTTACGAGTTGTATCTCGAGATACAACTCGTAAGATCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172824.1-910s1c1
Sequence:CCGGCTGGATCTTACGAGTTGTATTCTCGAGAATACAACTCGTAAGATCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172824.1-145s1c1
Sequence:CCGGCCTGGAGCTAAGTTACCAAATCTCGAGATTTGGTAACTTAGCTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183324    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172824.1-2787s1c1
Sequence:CCGGGCCTGGTATTTAAAGGAATAACTCGAGTTATTCCTTTAAATACCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172824
CCDC14 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 14
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172824.1-978s1c1
Sequence:CCGGCCAAACACACACGTCTCTGTTCTCGAGAACAGAGACGTGTGTGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172824.1-2576s1c1
Sequence:CCGGGCAAGTATCTTGCCATCTCATCTCGAGATGAGATGGCAAGATACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172824.1-909s1c1
Sequence:CCGGGCTGGATCTTACGAGTTGTATCTCGAGATACAACTCGTAAGATCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172824.1-910s1c1
Sequence:CCGGCTGGATCTTACGAGTTGTATTCTCGAGAATACAACTCGTAAGATCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172824.1-145s1c1
Sequence:CCGGCCTGGAGCTAAGTTACCAAATCTCGAGATTTGGTAACTTAGCTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183324    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172824.1-2787s1c1
Sequence:CCGGGCCTGGTATTTAAAGGAATAACTCGAGTTATTCCTTTAAATACCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)