EMAIL THIS PAGE TO A FRIEND

CCDC150

coiled-coil domain containing 150

174 Gene Product Result for
UniProtKB ID: Q8NCX0, Q6P5U6, Q6P663, Q8N8V5
Gene ID:
Mouse(78016) coiled-coil domain containing 150
Rat(316399) coiled-coil domain containing 150
sheep(101123103) coiled-coil domain containing 150
Domestic Rabbit(100347977) coiled-coil domain containing 150
domestic guinea pig(100724346) coiled-coil domain containing 150
naked mole-rat(101710799) coiled-coil domain containing 150
cow(509158) coiled-coil domain containing 150
Horse(100070375) coiled-coil domain containing 150
dog(488455) coiled-coil domain containing 150
domestic cat(101087509) coiled-coil domain containing 150
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030025 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030025 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030025 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173646 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173646 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173646 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080539 Rosetta Predictions human pricing
XM_930591 Rosetta Predictions human pricing
XM_001066248 Rosetta Predictions rat pricing
XM_237151 Rosetta Predictions rat pricing
NM_030025 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080539 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315811 predicted 1555
2 SASI_Hs02_00315812 predicted 2623
3 SASI_Hs02_00315813 predicted 552
4 SASI_Hs02_00315814 predicted 3340
5 SASI_Hs02_00315815 predicted 216
6 SASI_Hs02_00315816 predicted 2906
7 SASI_Hs02_00315817 predicted 3245
8 SASI_Hs02_00315818 predicted 417
9 SASI_Hs02_00315819 predicted 3351
10 SASI_Hs02_00315820 predicted 1475
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930591 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282189 predicted 1114
2 SASI_Hs01_00282190 predicted 260
3 SASI_Hs01_00282191 predicted 252
4 SASI_Hs01_00282192 predicted 965
5 SASI_Hs01_00282193 predicted 486
6 SASI_Hs01_00282194 predicted 337
7 SASI_Hs01_00282195 predicted 921
8 SASI_Hs01_00282196 predicted 1421
9 SASI_Hs01_00282197 predicted 1342
10 SASI_Hs01_00282198 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066248 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00316814 predicted 2792
2 SASI_Rn02_00316815 predicted 2261
3 SASI_Rn02_00316816 predicted 2917
4 SASI_Rn02_00316817 predicted 1402
5 SASI_Rn02_00316818 predicted 1038
6 SASI_Rn02_00316819 predicted 1491
7 SASI_Rn02_00316820 predicted 1969
8 SASI_Rn02_00316821 predicted 2768
9 SASI_Rn02_00316822 predicted 549
10 SASI_Rn02_00316823 predicted 2739
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237151 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390667 predicted 2795
2 SASI_Rn02_00390668 predicted 2265
3 SASI_Rn02_00390669 predicted 2914
4 SASI_Rn02_00390670 predicted 1399
5 SASI_Rn02_00390671 predicted 1039
6 SASI_Rn02_00390672 predicted 1492
7 SASI_Rn02_00390673 predicted 1974
8 SASI_Rn02_00390674 predicted 2760
9 SASI_Rn02_00390675 predicted 557
10 SASI_Rn02_00390676 predicted 2737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030025 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075111 predicted 2443
2 SASI_Mm02_00336401 predicted 1613
3 SASI_Mm02_00336402 predicted 476
4 SASI_Mm01_00075113 predicted 2456
5 SASI_Mm01_00075114 predicted 3079
6 SASI_Mm01_00075115 predicted 3440
7 SASI_Mm02_00336403 predicted 2459
8 SASI_Mm01_00075117 predicted 1287
9 SASI_Mm01_00075118 predicted 3023
10 SASI_Mm01_00075119 predicted 474
11 SASI_Mm01_00075112 predicted 2174
12 SASI_Mm01_00075116 predicted 458
13 SASI_Mm01_00075120 predicted 1973
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030025
CCDC150 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 150
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030025.1-2631s1c1
Sequence:CCGGGCTGAGGAATCCAAAGTAGAACTCGAGTTCTACTTTGGATTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030025.1-3169s1c1
Sequence:CCGGGCAAGGAATTGGAAGAAACTACTCGAGTAGTTTCTTCCAATTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030025.1-902s1c1
Sequence:CCGGGCTCCTCAAAGTACAAGAGATCTCGAGATCTCTTGTACTTTGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030025.1-3615s1c1
Sequence:CCGGGCAGAACCAACCCATCTCTTTCTCGAGAAAGAGATGGGTTGGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030025
CCDC150 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 150
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030025.1-2631s1c1
Sequence:CCGGGCTGAGGAATCCAAAGTAGAACTCGAGTTCTACTTTGGATTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030025.1-3169s1c1
Sequence:CCGGGCAAGGAATTGGAAGAAACTACTCGAGTAGTTTCTTCCAATTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030025.1-902s1c1
Sequence:CCGGGCTCCTCAAAGTACAAGAGATCTCGAGATCTCTTGTACTTTGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030025.1-3615s1c1
Sequence:CCGGGCAGAACCAACCCATCTCTTTCTCGAGAAAGAGATGGGTTGGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030025
CCDC150 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 150
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030025.1-2631s1c1
Sequence:CCGGGCTGAGGAATCCAAAGTAGAACTCGAGTTCTACTTTGGATTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030025.1-3169s1c1
Sequence:CCGGGCAAGGAATTGGAAGAAACTACTCGAGTAGTTTCTTCCAATTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030025.1-902s1c1
Sequence:CCGGGCTCCTCAAAGTACAAGAGATCTCGAGATCTCTTGTACTTTGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030025.1-3615s1c1
Sequence:CCGGGCAGAACCAACCCATCTCTTTCTCGAGAAAGAGATGGGTTGGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173646
CCDC150 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 150
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137091    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173646.1-1584s1c1
Sequence:CCGGCCCAAGGTGTTCGGTCATATTCTCGAGAATATGACCGAACACCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135517    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173646.1-1041s1c1
Sequence:CCGGGCTAGAAATCACCCTCTTGTTCTCGAGAACAAGAGGGTGATTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134791    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173646.1-1377s1c1
Sequence:CCGGCCATGAATCGTTGATGACTTACTCGAGTAAGTCATCAACGATTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173646.1-208s1c1
Sequence:CCGGGCTTCTGAAACATTCACAGTACTCGAGTACTGTGAATGTTTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173646.1-604s1c1
Sequence:CCGGGTTATGAATTTGCGCCAGCAACTCGAGTTGCTGGCGCAAATTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173646.1-353s1c1
Sequence:CCGGGCCAGAAAGTCATTAGTCCTACTCGAGTAGGACTAATGACTTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173646.1-934s1c1
Sequence:CCGGGATTCTATACAGAGCGCTCAACTCGAGTTGAGCGCTCTGTATAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173646
CCDC150 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 150
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137091    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173646.1-1584s1c1
Sequence:CCGGCCCAAGGTGTTCGGTCATATTCTCGAGAATATGACCGAACACCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135517    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173646.1-1041s1c1
Sequence:CCGGGCTAGAAATCACCCTCTTGTTCTCGAGAACAAGAGGGTGATTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134791    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173646.1-1377s1c1
Sequence:CCGGCCATGAATCGTTGATGACTTACTCGAGTAAGTCATCAACGATTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173646.1-208s1c1
Sequence:CCGGGCTTCTGAAACATTCACAGTACTCGAGTACTGTGAATGTTTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173646.1-604s1c1
Sequence:CCGGGTTATGAATTTGCGCCAGCAACTCGAGTTGCTGGCGCAAATTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173646.1-353s1c1
Sequence:CCGGGCCAGAAAGTCATTAGTCCTACTCGAGTAGGACTAATGACTTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173646.1-934s1c1
Sequence:CCGGGATTCTATACAGAGCGCTCAACTCGAGTTGAGCGCTCTGTATAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173646
CCDC150 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 150
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137091    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173646.1-1584s1c1
Sequence:CCGGCCCAAGGTGTTCGGTCATATTCTCGAGAATATGACCGAACACCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135517    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173646.1-1041s1c1
Sequence:CCGGGCTAGAAATCACCCTCTTGTTCTCGAGAACAAGAGGGTGATTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134791    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173646.1-1377s1c1
Sequence:CCGGCCATGAATCGTTGATGACTTACTCGAGTAAGTCATCAACGATTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173646.1-208s1c1
Sequence:CCGGGCTTCTGAAACATTCACAGTACTCGAGTACTGTGAATGTTTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173646.1-604s1c1
Sequence:CCGGGTTATGAATTTGCGCCAGCAACTCGAGTTGCTGGCGCAAATTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173646.1-353s1c1
Sequence:CCGGGCCAGAAAGTCATTAGTCCTACTCGAGTAGGACTAATGACTTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173646.1-934s1c1
Sequence:CCGGGATTCTATACAGAGCGCTCAACTCGAGTTGAGCGCTCTGTATAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks