EMAIL THIS PAGE TO A FRIEND

CCDC151

coiled-coil domain containing 151

52 Gene Product Result for
UniProtKB ID: A5D8V7, Q96CG5
Gene ID:
Mouse(77609) coiled-coil domain containing 151
Rat(315465) coiled-coil domain containing 151
Zebrafish(555601) coiled-coil domain containing 151
domestic cat(101098932) coiled-coil domain containing 151
cow(517994) coiled-coil domain containing 151
dog(476706) coiled-coil domain containing 151
naked mole-rat(101713215) coiled-coil domain containing 151
domestic guinea pig(100721466) coiled-coil domain containing 151
sheep(101119302) coiled-coil domain containing 151
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029939 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029939 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029939 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145045 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145045 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145045 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059221 MISSION® esiRNA esiRNA human CCDC151 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145045 Rosetta Predictions human pricing
NM_001108130 Rosetta Predictions rat pricing
NM_029939 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034530 predicted 926
2 SASI_Hs01_00034531 predicted 1121
3 SASI_Hs01_00034532 predicted 834
4 SASI_Hs02_00364923 predicted 469
5 SASI_Hs01_00034533 predicted 1862
6 SASI_Hs01_00034535 predicted 1190
7 SASI_Hs02_00364924 predicted 445
8 SASI_Hs01_00034537 predicted 1051
9 SASI_Hs01_00034538 predicted 1029
10 SASI_Hs02_00364925 predicted 378
11 SASI_Hs01_00034534 predicted 1582
12 SASI_Hs01_00034536 predicted 1820
13 SASI_Hs01_00034539 predicted 992
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108130 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235654 predicted 308
2 SASI_Rn02_00235655 predicted 486
3 SASI_Rn02_00235656 predicted 556
4 SASI_Rn02_00235657 predicted 352
5 SASI_Rn02_00235658 predicted 702
6 SASI_Rn02_00235659 predicted 477
7 SASI_Rn02_00235660 predicted 670
8 SASI_Rn02_00235661 predicted 389
9 SASI_Rn02_00235662 predicted 674
10 SASI_Rn02_00235663 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029939 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133641 predicted 911
2 SASI_Mm01_00133642 predicted 1909
3 SASI_Mm01_00133643 predicted 1628
4 SASI_Mm01_00133644 predicted 1869
5 SASI_Mm01_00133645 predicted 1216
6 SASI_Mm01_00133646 predicted 938
7 SASI_Mm01_00133647 predicted 555
8 SASI_Mm01_00133648 predicted 1121
9 SASI_Mm01_00133650 predicted 1472
10 SASI_Mm02_00336230 predicted 1926
11 SASI_Mm01_00133649 predicted 349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029939
CCDC151 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 151
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029939.1-1921s1c1
Sequence:CCGGGCAATAGGTTGCGCAGATCTTCTCGAGAAGATCTGCGCAACCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029939.1-1884s1c1
Sequence:CCGGCGTTCCCAGAAGTTAATCGAACTCGAGTTCGATTAACTTCTGGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029939.1-1635s1c1
Sequence:CCGGGCTTACAATCTGCTGGTAGTTCTCGAGAACTACCAGCAGATTGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029939.1-1043s1c1
Sequence:CCGGGCATTACATAACTGACTGCAACTCGAGTTGCAGTCAGTTATGTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029939
CCDC151 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 151
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029939.1-1921s1c1
Sequence:CCGGGCAATAGGTTGCGCAGATCTTCTCGAGAAGATCTGCGCAACCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029939.1-1884s1c1
Sequence:CCGGCGTTCCCAGAAGTTAATCGAACTCGAGTTCGATTAACTTCTGGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029939.1-1635s1c1
Sequence:CCGGGCTTACAATCTGCTGGTAGTTCTCGAGAACTACCAGCAGATTGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029939.1-1043s1c1
Sequence:CCGGGCATTACATAACTGACTGCAACTCGAGTTGCAGTCAGTTATGTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029939
CCDC151 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 151
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029939.1-1921s1c1
Sequence:CCGGGCAATAGGTTGCGCAGATCTTCTCGAGAAGATCTGCGCAACCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029939.1-1884s1c1
Sequence:CCGGCGTTCCCAGAAGTTAATCGAACTCGAGTTCGATTAACTTCTGGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029939.1-1635s1c1
Sequence:CCGGGCTTACAATCTGCTGGTAGTTCTCGAGAACTACCAGCAGATTGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029939.1-1043s1c1
Sequence:CCGGGCATTACATAACTGACTGCAACTCGAGTTGCAGTCAGTTATGTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145045
CCDC151 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 151
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-801s1c1
Sequence:CCGGCAAGGCCTATCTAATGGACGACTCGAGTCGTCCATTAGATAGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-1164s1c1
Sequence:CCGGGATGGAGGTGATCTTTGGCAACTCGAGTTGCCAAAGATCACCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-1839s1c1
Sequence:CCGGCCAGAAATTAATCGAAAGTCACTCGAGTGACTTTCGATTAATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-999s1c1
Sequence:CCGGCTACATAAGTGAGTGCAAGAACTCGAGTTCTTGCACTCACTTATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-807s1c1
Sequence:CCGGCTATCTAATGGACGAGAGCCTCTCGAGAGGCTCTCGTCCATTAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-998s1c1
Sequence:CCGGGCTACATAAGTGAGTGCAAGACTCGAGTCTTGCACTCACTTATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-1576s1c1
Sequence:CCGGGCAGATAACTATGTGCCAAACCTCGAGGTTTGGCACATAGTTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-1827s1c1
Sequence:CCGGCAAGATCCGTTCCCAGAAATTCTCGAGAATTTCTGGGAACGGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-1158s1c1
Sequence:CCGGGTACCAGATGGAGGTGATCTTCTCGAGAAGATCACCTCCATCTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-1026s1c1
Sequence:CCGGCGAGGAGAAGAAACTGGAGAACTCGAGTTCTCCAGTTTCTTCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145045
CCDC151 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 151
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-801s1c1
Sequence:CCGGCAAGGCCTATCTAATGGACGACTCGAGTCGTCCATTAGATAGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-1164s1c1
Sequence:CCGGGATGGAGGTGATCTTTGGCAACTCGAGTTGCCAAAGATCACCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-1839s1c1
Sequence:CCGGCCAGAAATTAATCGAAAGTCACTCGAGTGACTTTCGATTAATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-999s1c1
Sequence:CCGGCTACATAAGTGAGTGCAAGAACTCGAGTTCTTGCACTCACTTATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-807s1c1
Sequence:CCGGCTATCTAATGGACGAGAGCCTCTCGAGAGGCTCTCGTCCATTAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-998s1c1
Sequence:CCGGGCTACATAAGTGAGTGCAAGACTCGAGTCTTGCACTCACTTATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-1576s1c1
Sequence:CCGGGCAGATAACTATGTGCCAAACCTCGAGGTTTGGCACATAGTTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-1827s1c1
Sequence:CCGGCAAGATCCGTTCCCAGAAATTCTCGAGAATTTCTGGGAACGGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-1158s1c1
Sequence:CCGGGTACCAGATGGAGGTGATCTTCTCGAGAAGATCACCTCCATCTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-1026s1c1
Sequence:CCGGCGAGGAGAAGAAACTGGAGAACTCGAGTTCTCCAGTTTCTTCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145045
CCDC151 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 151
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-801s1c1
Sequence:CCGGCAAGGCCTATCTAATGGACGACTCGAGTCGTCCATTAGATAGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-1164s1c1
Sequence:CCGGGATGGAGGTGATCTTTGGCAACTCGAGTTGCCAAAGATCACCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-1839s1c1
Sequence:CCGGCCAGAAATTAATCGAAAGTCACTCGAGTGACTTTCGATTAATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-999s1c1
Sequence:CCGGCTACATAAGTGAGTGCAAGAACTCGAGTTCTTGCACTCACTTATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-807s1c1
Sequence:CCGGCTATCTAATGGACGAGAGCCTCTCGAGAGGCTCTCGTCCATTAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-998s1c1
Sequence:CCGGGCTACATAAGTGAGTGCAAGACTCGAGTCTTGCACTCACTTATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-1576s1c1
Sequence:CCGGGCAGATAACTATGTGCCAAACCTCGAGGTTTGGCACATAGTTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-1827s1c1
Sequence:CCGGCAAGATCCGTTCCCAGAAATTCTCGAGAATTTCTGGGAACGGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-1158s1c1
Sequence:CCGGGTACCAGATGGAGGTGATCTTCTCGAGAAGATCACCTCCATCTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145045.3-1026s1c1
Sequence:CCGGCGAGGAGAAGAAACTGGAGAACTCGAGTTCTCCAGTTTCTTCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks