EMAIL THIS PAGE TO A FRIEND

CCDC152

coiled-coil domain containing 152

69 Gene Product Result for
Synonyms: CH5400
UniProtKB ID: Q4G0S7, B3KXI4, Q5BLP6
Gene ID:
Mouse(100039139) coiled-coil domain containing 152
Rat(499536) coiled-coil domain containing 152
sheep(101116092) coiled-coil domain containing 152
domestic guinea pig(100732844) coiled-coil domain containing 152
naked mole-rat(101715087) coiled-coil domain containing 152
chicken(101747341) coiled-coil domain containing 152
cow(767877) coiled-coil domain containing 152
domestic cat(101093498) coiled-coil domain containing 152
dog(100687996) coiled-coil domain containing 152
chicken(101664887) coiled-coil domain containing 152
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA036240 Anti-CCDC152 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001134848 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001134848 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001134848 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714967 Rosetta Predictions human pricing
XM_001716661 Rosetta Predictions human pricing
XM_001717416 Rosetta Predictions human pricing
XM_001054085 Rosetta Predictions rat pricing
XM_574857 Rosetta Predictions rat pricing
XM_001472338 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00400596 predicted 610
2 SASI_Hs02_00400597 predicted 991
3 SASI_Hs02_00400598 predicted 340
4 SASI_Hs02_00400599 predicted 520
5 SASI_Hs02_00400600 predicted 490
6 SASI_Hs02_00400601 predicted 1056
7 SASI_Hs02_00400602 predicted 604
8 SASI_Hs02_00400603 predicted 1137
9 SASI_Hs02_00400604 predicted 1105
10 SASI_Hs02_00400605 predicted 1154
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00412037 predicted 614
2 SASI_Hs02_00412038 predicted 988
3 SASI_Hs02_00412039 predicted 339
4 SASI_Hs02_00412040 predicted 523
5 SASI_Hs02_00412041 predicted 497
6 SASI_Hs02_00412042 predicted 1057
7 SASI_Hs02_00412043 predicted 597
8 SASI_Hs02_00412044 predicted 1138
9 SASI_Hs02_00412045 predicted 1107
10 SASI_Hs02_00412046 predicted 1154
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00417093 predicted 605
2 SASI_Hs02_00417094 predicted 983
3 SASI_Hs02_00417095 predicted 336
4 SASI_Hs02_00417096 predicted 523
5 SASI_Hs02_00417097 predicted 499
6 SASI_Hs02_00417098 predicted 1054
7 SASI_Hs02_00417099 predicted 605
8 SASI_Hs02_00417100 predicted 1135
9 SASI_Hs02_00417101 predicted 1104
10 SASI_Hs02_00417102 predicted 1145
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054085 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274657 predicted 522
2 SASI_Rn02_00274658 predicted 383
3 SASI_Rn02_00274659 predicted 442
4 SASI_Rn02_00274660 predicted 316
5 SASI_Rn02_00274661 predicted 268
6 SASI_Rn02_00274662 predicted 256
7 SASI_Rn02_00274663 predicted 546
8 SASI_Rn02_00274664 predicted 263
9 SASI_Rn02_00274665 predicted 707
10 SASI_Rn02_00274666 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574857 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402722 predicted 524
2 SASI_Rn02_00402723 predicted 390
3 SASI_Rn02_00402724 predicted 442
4 SASI_Rn02_00402725 predicted 316
5 SASI_Rn02_00402726 predicted 268
6 SASI_Rn02_00402727 predicted 247
7 SASI_Rn02_00402728 predicted 546
8 SASI_Rn02_00402729 predicted 258
9 SASI_Rn02_00402730 predicted 707
10 SASI_Rn02_00402731 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001472338 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00360844 predicted 537
2 SASI_Mm02_00360845 predicted 216
3 SASI_Mm02_00360846 predicted 483
4 SASI_Mm02_00360847 predicted 308
5 SASI_Mm02_00360848 predicted 393
6 SASI_Mm02_00360849 predicted 445
7 SASI_Mm02_00360850 predicted 389
8 SASI_Mm02_00360851 predicted 536
9 SASI_Mm02_00360852 predicted 384
10 SASI_Mm02_00360853 predicted 473
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001134848
CCDC152 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 152
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134848.1-642s21c1
Sequence:CCGGTAGCAAGAGTTCAGACTAAATCTCGAGATTTAGTCTGAACTCTTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134848.1-3231s21c1
Sequence:CCGGCGACTCCCATTGACCATAATACTCGAGTATTATGGTCAATGGGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134848.1-747s21c1
Sequence:CCGGAGATTGCAATTCTTCGTAATACTCGAGTATTACGAAGAATTGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134848.1-385s21c1
Sequence:CCGGGTCTCATGAACAGGAATATAACTCGAGTTATATTCCTGTTCATGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134848.1-440s21c1
Sequence:CCGGATCAAAGAGGAGGGATATAAGCTCGAGCTTATATCCCTCCTCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001134848
CCDC152 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 152
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134848.1-642s21c1
Sequence:CCGGTAGCAAGAGTTCAGACTAAATCTCGAGATTTAGTCTGAACTCTTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134848.1-3231s21c1
Sequence:CCGGCGACTCCCATTGACCATAATACTCGAGTATTATGGTCAATGGGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134848.1-747s21c1
Sequence:CCGGAGATTGCAATTCTTCGTAATACTCGAGTATTACGAAGAATTGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134848.1-385s21c1
Sequence:CCGGGTCTCATGAACAGGAATATAACTCGAGTTATATTCCTGTTCATGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134848.1-440s21c1
Sequence:CCGGATCAAAGAGGAGGGATATAAGCTCGAGCTTATATCCCTCCTCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001134848
CCDC152 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 152
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134848.1-642s21c1
Sequence:CCGGTAGCAAGAGTTCAGACTAAATCTCGAGATTTAGTCTGAACTCTTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134848.1-3231s21c1
Sequence:CCGGCGACTCCCATTGACCATAATACTCGAGTATTATGGTCAATGGGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134848.1-747s21c1
Sequence:CCGGAGATTGCAATTCTTCGTAATACTCGAGTATTACGAAGAATTGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134848.1-385s21c1
Sequence:CCGGGTCTCATGAACAGGAATATAACTCGAGTTATATTCCTGTTCATGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134848.1-440s21c1
Sequence:CCGGATCAAAGAGGAGGGATATAAGCTCGAGCTTATATCCCTCCTCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks