EMAIL THIS PAGE TO A FRIEND

CCDC154

coiled-coil domain containing 154

70 Gene Product Result for
Synonyms: C16orf29
UniProtKB ID: A6NI56, G9JV18
Gene ID:
Mouse(207209) coiled-coil domain containing 154
Rat(287131) coiled-coil domain containing 154
sheep(101107406) coiled-coil domain containing 154
domestic guinea pig(100727898) coiled-coil domain containing 154
naked mole-rat(101721273) coiled-coil domain containing 154
dog(100685080) coiled-coil domain containing 154
Horse(100067669) coiled-coil domain containing 154
cow(101904581) coiled-coil domain containing 154
domestic cat(101087545) coiled-coil domain containing 154
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001143980 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001143980 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001143980 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_928800 Rosetta Predictions human pricing
XM_001059305 Rosetta Predictions rat pricing
XM_237757 Rosetta Predictions rat pricing
XM_001479029 Rosetta Predictions mouse pricing
XM_139904 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00275156 predicted 1497
2 SASI_Hs01_00275157 predicted 1883
3 SASI_Hs01_00275158 predicted 1996
4 SASI_Hs01_00275159 predicted 1535
5 SASI_Hs01_00275160 predicted 1953
6 SASI_Hs01_00275161 predicted 1527
7 SASI_Hs01_00275162 predicted 1908
8 SASI_Hs01_00275163 predicted 1101
9 SASI_Hs01_00275164 predicted 1060
10 SASI_Hs01_00275165 predicted 2138
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059305 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292787 predicted 487
2 SASI_Rn02_00292788 predicted 951
3 SASI_Rn02_00292789 predicted 1070
4 SASI_Rn02_00292790 predicted 2000
5 SASI_Rn02_00292791 predicted 1249
6 SASI_Rn02_00292792 predicted 852
7 SASI_Rn02_00292793 predicted 647
8 SASI_Rn02_00292794 predicted 1941
9 SASI_Rn02_00292795 predicted 1395
10 SASI_Rn02_00292796 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237757 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391066 predicted 397
2 SASI_Rn02_00391067 predicted 2194
3 SASI_Rn02_00391068 predicted 2192
4 SASI_Rn02_00391069 predicted 2170
5 SASI_Rn02_00391070 predicted 2156
6 SASI_Rn02_00391071 predicted 399
7 SASI_Rn02_00391072 predicted 2160
8 SASI_Rn02_00391073 predicted 2189
9 SASI_Rn02_00391074 predicted 2187
10 SASI_Rn02_00391075 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479029 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00407115 predicted 1492
2 SASI_Mm02_00407116 predicted 1077
3 SASI_Mm02_00407117 predicted 418
4 SASI_Mm02_00407118 predicted 967
5 SASI_Mm02_00407119 predicted 514
6 SASI_Mm02_00407120 predicted 771
7 SASI_Mm02_00407121 predicted 980
8 SASI_Mm02_00407122 predicted 1373
9 SASI_Mm02_00407123 predicted 1419
10 SASI_Mm02_00407124 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_139904 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244635 predicted 1499
2 SASI_Mm02_00424906 predicted 1073
3 SASI_Mm02_00424907 predicted 413
4 SASI_Mm02_00424908 predicted 964
5 SASI_Mm02_00424909 predicted 515
6 SASI_Mm02_00424910 predicted 770
7 SASI_Mm02_00424911 predicted 979
8 SASI_Mm02_00424912 predicted 1412
9 SASI_Mm02_00424913 predicted 699
10 SASI_Mm02_00424914 predicted 337
11 SASI_Mm01_00244633 predicted 2093
12 SASI_Mm01_00244634 predicted 2258
13 SASI_Mm01_00244636 predicted 1980
14 SASI_Mm01_00244637 predicted 2201
15 SASI_Mm01_00244638 predicted 2143
16 SASI_Mm01_00244639 predicted 1552
17 SASI_Mm01_00244640 predicted 2274
18 SASI_Mm01_00244641 predicted 1704
19 SASI_Mm01_00244642 predicted 1703
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001143980
CCDC154 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 154
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143980.1-313s21c1
Sequence:CCGGATGAGTCCAGCCATCCGACATCTCGAGATGTCGGATGGCTGGACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143980.1-1701s21c1
Sequence:CCGGTCATCCGTGCAGCTGCTAAAGCTCGAGCTTTAGCAGCTGCACGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143980.1-1592s21c1
Sequence:CCGGCGACAAGTGCCTGCTTCATAACTCGAGTTATGAAGCAGGCACTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143980.1-1615s21c1
Sequence:CCGGGCGACTCAGACCTCAGGATTTCTCGAGAAATCCTGAGGTCTGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143980.1-1769s21c1
Sequence:CCGGCACGTTTCAGAACCAAATAATCTCGAGATTATTTGGTTCTGAAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001143980
CCDC154 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 154
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143980.1-313s21c1
Sequence:CCGGATGAGTCCAGCCATCCGACATCTCGAGATGTCGGATGGCTGGACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143980.1-1701s21c1
Sequence:CCGGTCATCCGTGCAGCTGCTAAAGCTCGAGCTTTAGCAGCTGCACGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143980.1-1592s21c1
Sequence:CCGGCGACAAGTGCCTGCTTCATAACTCGAGTTATGAAGCAGGCACTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143980.1-1615s21c1
Sequence:CCGGGCGACTCAGACCTCAGGATTTCTCGAGAAATCCTGAGGTCTGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143980.1-1769s21c1
Sequence:CCGGCACGTTTCAGAACCAAATAATCTCGAGATTATTTGGTTCTGAAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001143980
CCDC154 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 154
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143980.1-313s21c1
Sequence:CCGGATGAGTCCAGCCATCCGACATCTCGAGATGTCGGATGGCTGGACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143980.1-1701s21c1
Sequence:CCGGTCATCCGTGCAGCTGCTAAAGCTCGAGCTTTAGCAGCTGCACGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143980.1-1592s21c1
Sequence:CCGGCGACAAGTGCCTGCTTCATAACTCGAGTTATGAAGCAGGCACTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143980.1-1615s21c1
Sequence:CCGGGCGACTCAGACCTCAGGATTTCTCGAGAAATCCTGAGGTCTGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143980.1-1769s21c1
Sequence:CCGGCACGTTTCAGAACCAAATAATCTCGAGATTATTTGGTTCTGAAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks