EMAIL THIS PAGE TO A FRIEND

CCDC155

coiled-coil domain containing 155

61 Gene Product Result for
Synonyms: KASH5
UniProtKB ID: Q8N6L0, Q96MC3
Gene ID:
Mouse(384619) coiled-coil domain containing 155
Rat(308581) coiled-coil domain containing 155
cow(617651) coiled-coil domain containing 155
dog(484380) coiled-coil domain containing 155
domestic cat(101097935) coiled-coil domain containing 155
naked mole-rat(101703123) coiled-coil domain containing 155
domestic guinea pig(100724823) coiled-coil domain containing 155
sheep(101105594) coiled-coil domain containing 155
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144688 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144688 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144688 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201374 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201374 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201374 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144688 Rosetta Predictions human pricing
XM_001080694 Rosetta Predictions rat pricing
XM_238811 Rosetta Predictions rat pricing
NM_201374 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144688 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161186 predicted 1064
2 SASI_Hs02_00364604 predicted 260
3 SASI_Hs02_00364605 predicted 1977
4 SASI_Hs02_00364606 predicted 1301
5 SASI_Hs01_00161187 predicted 1096
6 SASI_Hs01_00161188 predicted 289
7 SASI_Hs01_00161189 predicted 1149
8 SASI_Hs02_00364607 predicted 262
9 SASI_Hs01_00161191 predicted 2054
10 SASI_Hs01_00161192 predicted 378
11 SASI_Hs01_00161185 predicted 1923
12 SASI_Hs01_00161190 predicted 2993
13 SASI_Hs01_00161193 predicted 2128
14 SASI_Hs01_00161194 predicted 2178
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080694 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368990 predicted 997
2 SASI_Rn02_00368991 predicted 1077
3 SASI_Rn02_00368992 predicted 1080
4 SASI_Rn02_00368993 predicted 1391
5 SASI_Rn02_00368994 predicted 1161
6 SASI_Rn02_00368995 predicted 969
7 SASI_Rn02_00368996 predicted 1282
8 SASI_Rn02_00368997 predicted 357
9 SASI_Rn02_00368998 predicted 1372
10 SASI_Rn02_00368999 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_238811 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391456 predicted 994
2 SASI_Rn02_00391457 predicted 1079
3 SASI_Rn02_00391458 predicted 1076
4 SASI_Rn02_00391459 predicted 1395
5 SASI_Rn02_00391460 predicted 1162
6 SASI_Rn02_00391461 predicted 969
7 SASI_Rn02_00391462 predicted 1280
8 SASI_Rn02_00391463 predicted 358
9 SASI_Rn02_00391464 predicted 1374
10 SASI_Rn02_00391465 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201374 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073636 predicted 489
2 SASI_Mm01_00073637 predicted 1053
3 SASI_Mm01_00073638 predicted 603
4 SASI_Mm01_00073639 predicted 669
5 SASI_Mm01_00073640 predicted 643
6 SASI_Mm01_00073641 predicted 815
7 SASI_Mm01_00073642 predicted 1235
8 SASI_Mm01_00073643 predicted 658
9 SASI_Mm01_00073644 predicted 1262
10 SASI_Mm01_00073645 predicted 927
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144688
CCDC155 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 155
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144688.3-262s21c1
Sequence:CCGGGTCAGCTTGGAGGAGCAAATACTCGAGTATTTGCTCCTCCAAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144688.3-1061s21c1
Sequence:CCGGTTGAGTGTGAACACCTCATTTCTCGAGAAATGAGGTGTTCACACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144688.3-2070s21c1
Sequence:CCGGATTAAGCACTAAGGATTATTCCTCGAGGAATAATCCTTAGTGCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144688.3-1885s21c1
Sequence:CCGGAGCAGTGTCTAGCTCAATAAACTCGAGTTTATTGAGCTAGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144688.2-3725s1c1
Sequence:CCGGCCAGTAATGGATTAAGCACTACTCGAGTAGTGCTTAATCCATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144688.2-1887s1c1
Sequence:CCGGCTCGCAGAAAGACGTTCTGAACTCGAGTTCAGAACGTCTTTCTGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144688.2-2727s1c1
Sequence:CCGGGCTCTTTGAGTGTGAACACCTCTCGAGAGGTGTTCACACTCAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144688.2-2051s1c1
Sequence:CCGGCCCAGGATGCACGCCTCCAAACTCGAGTTTGGAGGCGTGCATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144688
CCDC155 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 155
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144688.3-262s21c1
Sequence:CCGGGTCAGCTTGGAGGAGCAAATACTCGAGTATTTGCTCCTCCAAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144688.3-1061s21c1
Sequence:CCGGTTGAGTGTGAACACCTCATTTCTCGAGAAATGAGGTGTTCACACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144688.3-2070s21c1
Sequence:CCGGATTAAGCACTAAGGATTATTCCTCGAGGAATAATCCTTAGTGCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144688.3-1885s21c1
Sequence:CCGGAGCAGTGTCTAGCTCAATAAACTCGAGTTTATTGAGCTAGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144688.2-3725s1c1
Sequence:CCGGCCAGTAATGGATTAAGCACTACTCGAGTAGTGCTTAATCCATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144688.2-1887s1c1
Sequence:CCGGCTCGCAGAAAGACGTTCTGAACTCGAGTTCAGAACGTCTTTCTGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144688.2-2727s1c1
Sequence:CCGGGCTCTTTGAGTGTGAACACCTCTCGAGAGGTGTTCACACTCAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144688.2-2051s1c1
Sequence:CCGGCCCAGGATGCACGCCTCCAAACTCGAGTTTGGAGGCGTGCATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144688
CCDC155 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 155
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144688.3-262s21c1
Sequence:CCGGGTCAGCTTGGAGGAGCAAATACTCGAGTATTTGCTCCTCCAAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144688.3-1061s21c1
Sequence:CCGGTTGAGTGTGAACACCTCATTTCTCGAGAAATGAGGTGTTCACACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144688.3-2070s21c1
Sequence:CCGGATTAAGCACTAAGGATTATTCCTCGAGGAATAATCCTTAGTGCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144688.3-1885s21c1
Sequence:CCGGAGCAGTGTCTAGCTCAATAAACTCGAGTTTATTGAGCTAGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144688.2-3725s1c1
Sequence:CCGGCCAGTAATGGATTAAGCACTACTCGAGTAGTGCTTAATCCATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144688.2-1887s1c1
Sequence:CCGGCTCGCAGAAAGACGTTCTGAACTCGAGTTCAGAACGTCTTTCTGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144688.2-2727s1c1
Sequence:CCGGGCTCTTTGAGTGTGAACACCTCTCGAGAGGTGTTCACACTCAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144688.2-2051s1c1
Sequence:CCGGCCCAGGATGCACGCCTCCAAACTCGAGTTTGGAGGCGTGCATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201374
CCDC155 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 155
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000182290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201374.1-1192s1c1
Sequence:CCGGGAGGAGAATGAGAAGCTGCTACTCGAGTAGCAGCTTCTCATTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201374.1-1509s1c1
Sequence:CCGGCCCATCACTAGACTTGGAGATCTCGAGATCTCCAAGTCTAGTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201374.1-1389s1c1
Sequence:CCGGCCAGGAACTAAGGCAAGAGATCTCGAGATCTCTTGCCTTAGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201374.1-1286s1c1
Sequence:CCGGGTGAGTGCGAACGACTCATTTCTCGAGAAATGAGTCGTTCGCACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201374
CCDC155 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 155
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000182290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201374.1-1192s1c1
Sequence:CCGGGAGGAGAATGAGAAGCTGCTACTCGAGTAGCAGCTTCTCATTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201374.1-1509s1c1
Sequence:CCGGCCCATCACTAGACTTGGAGATCTCGAGATCTCCAAGTCTAGTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201374.1-1389s1c1
Sequence:CCGGCCAGGAACTAAGGCAAGAGATCTCGAGATCTCTTGCCTTAGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201374.1-1286s1c1
Sequence:CCGGGTGAGTGCGAACGACTCATTTCTCGAGAAATGAGTCGTTCGCACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201374
CCDC155 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 155
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000182290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201374.1-1192s1c1
Sequence:CCGGGAGGAGAATGAGAAGCTGCTACTCGAGTAGCAGCTTCTCATTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201374.1-1509s1c1
Sequence:CCGGCCCATCACTAGACTTGGAGATCTCGAGATCTCCAAGTCTAGTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201374.1-1389s1c1
Sequence:CCGGCCAGGAACTAAGGCAAGAGATCTCGAGATCTCTTGCCTTAGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201374.1-1286s1c1
Sequence:CCGGGTGAGTGCGAACGACTCATTTCTCGAGAAATGAGTCGTTCGCACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks