EMAIL THIS PAGE TO A FRIEND

CCDC157

coiled-coil domain containing 157

UniProtKB ID: Q569K6, Q0VD76, Q9BYA4
Gene ID:
Mouse(216516) coiled-coil domain containing 157
Rat(681091) coiled-coil domain containing 157
sheep(101123238) coiled-coil domain containing 157
domestic guinea pig(100723864) coiled-coil domain containing 157
naked mole-rat(101715536) coiled-coil domain containing 157
Zebrafish(368731) coiled-coil domain containing 157
cow(100125300) coiled-coil domain containing 157
domestic cat(101091230) coiled-coil domain containing 157
dog(100687232) coiled-coil domain containing 157
chicken(417010) coiled-coil domain containing 157
38 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177616 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177616 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177616 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001017437 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017437 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017437 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU006371 MISSION® esiRNA esiRNA targeting mouse 4930562D19Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017437 Rosetta Predictions human pricing
XM_001062582 Rosetta Predictions rat pricing
NM_177616 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220096 predicted 1138
2 SASI_Hs01_00220097 predicted 1332
3 SASI_Hs01_00220099 predicted 563
4 SASI_Hs01_00220100 predicted 1028
5 SASI_Hs01_00220101 predicted 1853
6 SASI_Hs01_00220102 predicted 1954
7 SASI_Hs01_00220103 predicted 2258
8 SASI_Hs01_00220104 predicted 1950
9 SASI_Hs01_00220105 predicted 1127
10 SASI_Hs02_00306763 predicted 1841
11 SASI_Hs01_00220098 predicted 873
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062582 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00303899 predicted 28
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177616 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055549 predicted 916
2 SASI_Mm02_00347844 predicted 1267
3 SASI_Mm01_00055546 predicted 2103
4 SASI_Mm02_00347845 predicted 3028
5 SASI_Mm01_00055548 predicted 2114
6 SASI_Mm02_00347846 predicted 2941
7 SASI_Mm02_00347847 predicted 2496
8 SASI_Mm02_00347848 predicted 2843
9 SASI_Mm02_00347849 predicted 2931
10 SASI_Mm02_00347850 predicted 964
11 SASI_Mm01_00055543 predicted 2086
12 SASI_Mm01_00055544 predicted 2270
13 SASI_Mm01_00055545 predicted 1118
14 SASI_Mm01_00055547 predicted 1057
15 SASI_Mm01_00055550 predicted 986
16 SASI_Mm01_00055551 predicted 2176
17 SASI_Mm01_00055552 predicted 2070
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177616
VALIDATED
CCDC157 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 157
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000199005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177616.2-1062s1c1
Sequence:CCGGGCAAGGTTGTTATCAGCCTGTCTCGAGACAGGCTGATAACAACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177616.2-2071s1c1
Sequence:CCGGGCAAGTGCAAGCCAATGCTATCTCGAGATAGCATTGGCTTGCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177616.2-2077s1c1
Sequence:CCGGGCAAGCCAATGCTATCCGTATCTCGAGATACGGATAGCATTGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177616.2-846s1c1
Sequence:CCGGCGGAATGTATGACTGCCAAGTCTCGAGACTTGGCAGTCATACATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177616
VALIDATED
CCDC157 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 157
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000199005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177616.2-1062s1c1
Sequence:CCGGGCAAGGTTGTTATCAGCCTGTCTCGAGACAGGCTGATAACAACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177616.2-2071s1c1
Sequence:CCGGGCAAGTGCAAGCCAATGCTATCTCGAGATAGCATTGGCTTGCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177616.2-2077s1c1
Sequence:CCGGGCAAGCCAATGCTATCCGTATCTCGAGATACGGATAGCATTGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177616.2-846s1c1
Sequence:CCGGCGGAATGTATGACTGCCAAGTCTCGAGACTTGGCAGTCATACATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177616
VALIDATED
CCDC157 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 157
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000199005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177616.2-1062s1c1
Sequence:CCGGGCAAGGTTGTTATCAGCCTGTCTCGAGACAGGCTGATAACAACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177616.2-2071s1c1
Sequence:CCGGGCAAGTGCAAGCCAATGCTATCTCGAGATAGCATTGGCTTGCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177616.2-2077s1c1
Sequence:CCGGGCAAGCCAATGCTATCCGTATCTCGAGATACGGATAGCATTGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177616.2-846s1c1
Sequence:CCGGCGGAATGTATGACTGCCAAGTCTCGAGACTTGGCAGTCATACATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017437
CCDC157 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 157
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017437.1-552s1c1
Sequence:CCGGGCTGCTGCTTCAAAGCTGTATCTCGAGATACAGCTTTGAAGCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017437.1-1995s1c1
Sequence:CCGGCCAGATAACATGTCCCACAGACTCGAGTCTGTGGGACATGTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017437.1-558s1c1
Sequence:CCGGGCTTCAAAGCTGTATGAGCTACTCGAGTAGCTCATACAGCTTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017437.1-800s1c1
Sequence:CCGGCCAAGTTAATCAAGCCCTCCTCTCGAGAGGAGGGCTTGATTAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017437.1-1985s1c1
Sequence:CCGGGCGTGGAATCCCAGATAACATCTCGAGATGTTATCTGGGATTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017437.1-782s1c1
Sequence:CCGGGCCCTGAATATCTGACTACCACTCGAGTGGTAGTCAGATATTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017437
CCDC157 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 157
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017437.1-552s1c1
Sequence:CCGGGCTGCTGCTTCAAAGCTGTATCTCGAGATACAGCTTTGAAGCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017437.1-1995s1c1
Sequence:CCGGCCAGATAACATGTCCCACAGACTCGAGTCTGTGGGACATGTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017437.1-558s1c1
Sequence:CCGGGCTTCAAAGCTGTATGAGCTACTCGAGTAGCTCATACAGCTTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017437.1-800s1c1
Sequence:CCGGCCAAGTTAATCAAGCCCTCCTCTCGAGAGGAGGGCTTGATTAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017437.1-1985s1c1
Sequence:CCGGGCGTGGAATCCCAGATAACATCTCGAGATGTTATCTGGGATTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017437.1-782s1c1
Sequence:CCGGGCCCTGAATATCTGACTACCACTCGAGTGGTAGTCAGATATTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017437
CCDC157 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 157
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017437.1-552s1c1
Sequence:CCGGGCTGCTGCTTCAAAGCTGTATCTCGAGATACAGCTTTGAAGCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017437.1-1995s1c1
Sequence:CCGGCCAGATAACATGTCCCACAGACTCGAGTCTGTGGGACATGTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017437.1-558s1c1
Sequence:CCGGGCTTCAAAGCTGTATGAGCTACTCGAGTAGCTCATACAGCTTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017437.1-800s1c1
Sequence:CCGGCCAAGTTAATCAAGCCCTCCTCTCGAGAGGAGGGCTTGATTAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017437.1-1985s1c1
Sequence:CCGGGCGTGGAATCCCAGATAACATCTCGAGATGTTATCTGGGATTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017437.1-782s1c1
Sequence:CCGGGCCCTGAATATCTGACTACCACTCGAGTGGTAGTCAGATATTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks