EMAIL THIS PAGE TO A FRIEND

CCDC158

coiled-coil domain containing 158

98 Gene Product Result for
UniProtKB ID: Q5M9N0, Q8IYQ1, Q8N7D4, Q8N7E3
Gene ID:
Mouse(320696) coiled-coil domain containing 158
Rat(289502) coiled-coil domain containing 158
cow(534614) coiled-coil domain containing 158
Horse(100051211) coiled-coil domain containing 158
domestic cat(101098536) coiled-coil domain containing 158
dog(478436) coiled-coil domain containing 158
naked mole-rat(101714728) coiled-coil domain containing 158
domestic guinea pig(100713318) coiled-coil domain containing 158
sheep(101109802) coiled-coil domain containing 158
Domestic Rabbit(100351593) coiled-coil domain containing 158
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177230 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177230 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177230 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178555 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178555 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178555 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001042784 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001042784 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001042784 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042784 Rosetta Predictions human pricing
NM_178555 Rosetta Predictions human pricing
XM_001070834 Rosetta Predictions rat pricing
XM_223231 Rosetta Predictions rat pricing
NM_177230 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042784 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311229 predicted 2305
2 SASI_Hs02_00311230 predicted 1646
3 SASI_Hs02_00311231 predicted 714
4 SASI_Hs02_00311232 predicted 1197
5 SASI_Hs02_00311233 predicted 2775
6 SASI_Hs02_00311234 predicted 2102
7 SASI_Hs02_00311235 predicted 1568
8 SASI_Hs02_00311236 predicted 680
9 SASI_Hs02_00311237 predicted 2871
10 SASI_Hs02_00311238 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178555 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028742 predicted 1499
2 SASI_Hs01_00028743 predicted 873
3 SASI_Hs01_00028744 predicted 725
4 SASI_Hs01_00028745 predicted 1201
5 SASI_Hs01_00028746 predicted 433
6 SASI_Hs01_00028747 predicted 1566
7 SASI_Hs01_00028748 predicted 688
8 SASI_Hs01_00028749 predicted 1649
9 SASI_Hs01_00028750 predicted 575
10 SASI_Hs01_00028751 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070834 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00333010 predicted 3386
2 SASI_Rn02_00333011 predicted 2452
3 SASI_Rn02_00333012 predicted 985
4 SASI_Rn02_00333013 predicted 1225
5 SASI_Rn02_00333014 predicted 1633
6 SASI_Rn02_00333015 predicted 272
7 SASI_Rn02_00333016 predicted 2789
8 SASI_Rn02_00333017 predicted 2033
9 SASI_Rn02_00333018 predicted 651
10 SASI_Rn02_00333019 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223231 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381228 predicted 3385
2 SASI_Rn02_00381229 predicted 2457
3 SASI_Rn02_00381230 predicted 984
4 SASI_Rn02_00381231 predicted 1223
5 SASI_Rn02_00381232 predicted 1637
6 SASI_Rn02_00381233 predicted 272
7 SASI_Rn02_00381234 predicted 2790
8 SASI_Rn02_00381235 predicted 2024
9 SASI_Rn02_00381236 predicted 654
10 SASI_Rn02_00381237 predicted 617
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177230 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137991 predicted 3392
2 SASI_Mm01_00137992 predicted 1219
3 SASI_Mm01_00137993 predicted 355
4 SASI_Mm01_00137995 predicted 1188
5 SASI_Mm01_00137996 predicted 605
6 SASI_Mm01_00137997 predicted 2168
7 SASI_Mm02_00347260 predicted 2031
8 SASI_Mm01_00137998 predicted 2660
9 SASI_Mm01_00137999 predicted 911
10 SASI_Mm02_00347261 predicted 893
11 SASI_Mm01_00137994 predicted 1643
12 SASI_Mm01_00138000 predicted 749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177230
CCDC158 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 158
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177230.2-1775s1c1
Sequence:CCGGGAGCTTCAACACCTGAAGAATCTCGAGATTCTTCAGGTGTTGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177230.2-2199s1c1
Sequence:CCGGCAGAGGACTATGAAGTCTTAACTCGAGTTAAGACTTCATAGTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177230.2-3341s1c1
Sequence:CCGGCCGTCATTAGAAACAACAGGACTCGAGTCCTGTTGTTTCTAATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177230.2-749s1c1
Sequence:CCGGCGATCAATCTTAGTTGACTTTCTCGAGAAAGTCAACTAAGATTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177230
CCDC158 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 158
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177230.2-1775s1c1
Sequence:CCGGGAGCTTCAACACCTGAAGAATCTCGAGATTCTTCAGGTGTTGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177230.2-2199s1c1
Sequence:CCGGCAGAGGACTATGAAGTCTTAACTCGAGTTAAGACTTCATAGTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177230.2-3341s1c1
Sequence:CCGGCCGTCATTAGAAACAACAGGACTCGAGTCCTGTTGTTTCTAATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177230.2-749s1c1
Sequence:CCGGCGATCAATCTTAGTTGACTTTCTCGAGAAAGTCAACTAAGATTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177230
CCDC158 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 158
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177230.2-1775s1c1
Sequence:CCGGGAGCTTCAACACCTGAAGAATCTCGAGATTCTTCAGGTGTTGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177230.2-2199s1c1
Sequence:CCGGCAGAGGACTATGAAGTCTTAACTCGAGTTAAGACTTCATAGTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177230.2-3341s1c1
Sequence:CCGGCCGTCATTAGAAACAACAGGACTCGAGTCCTGTTGTTTCTAATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177230.2-749s1c1
Sequence:CCGGCGATCAATCTTAGTTGACTTTCTCGAGAAAGTCAACTAAGATTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178555
CCDC158 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 158
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000167092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178555.2-1436s1c1
Sequence:CCGGCTTCTCGTTCATTCAATTCTTCTCGAGAAGAATTGAATGAACGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178555
CCDC158 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 158
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000167092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178555.2-1436s1c1
Sequence:CCGGCTTCTCGTTCATTCAATTCTTCTCGAGAAGAATTGAATGAACGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178555
CCDC158 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 158
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000167092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178555.2-1436s1c1
Sequence:CCGGCTTCTCGTTCATTCAATTCTTCTCGAGAAGAATTGAATGAACGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042784
CCDC158 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 158
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042784.1-952s21c1
Sequence:CCGGGATAGGATTGAGCAGTTAATACTCGAGTATTAACTGCTCAATCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042784.1-2969s21c1
Sequence:CCGGATAGGGTAAGAGATTGCATTACTCGAGTAATGCAATCTCTTACCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042784.1-801s21c1
Sequence:CCGGCAGCTTGGGCTCAGCTATTAGCTCGAGCTAATAGCTGAGCCCAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042784.1-248s21c1
Sequence:CCGGCATCTATTCGTGGTACAATAACTCGAGTTATTGTACCACGAATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042784.1-1236s21c1
Sequence:CCGGCCGGACAGAGCGTGATCAATTCTCGAGAATTGATCACGCTCTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042784
CCDC158 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 158
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042784.1-952s21c1
Sequence:CCGGGATAGGATTGAGCAGTTAATACTCGAGTATTAACTGCTCAATCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042784.1-2969s21c1
Sequence:CCGGATAGGGTAAGAGATTGCATTACTCGAGTAATGCAATCTCTTACCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042784.1-801s21c1
Sequence:CCGGCAGCTTGGGCTCAGCTATTAGCTCGAGCTAATAGCTGAGCCCAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042784.1-248s21c1
Sequence:CCGGCATCTATTCGTGGTACAATAACTCGAGTTATTGTACCACGAATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042784.1-1236s21c1
Sequence:CCGGCCGGACAGAGCGTGATCAATTCTCGAGAATTGATCACGCTCTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042784
CCDC158 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 158
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042784.1-952s21c1
Sequence:CCGGGATAGGATTGAGCAGTTAATACTCGAGTATTAACTGCTCAATCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042784.1-2969s21c1
Sequence:CCGGATAGGGTAAGAGATTGCATTACTCGAGTAATGCAATCTCTTACCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042784.1-801s21c1
Sequence:CCGGCAGCTTGGGCTCAGCTATTAGCTCGAGCTAATAGCTGAGCCCAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042784.1-248s21c1
Sequence:CCGGCATCTATTCGTGGTACAATAACTCGAGTTATTGTACCACGAATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042784.1-1236s21c1
Sequence:CCGGCCGGACAGAGCGTGATCAATTCTCGAGAATTGATCACGCTCTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks