EMAIL THIS PAGE TO A FRIEND

CCDC159

coiled-coil domain containing 159

165 Gene Product Result for
UniProtKB ID: P0C7I6, B4DEG3, B4DWR8, B4E133, B7ZAM4
Gene ID:
Mouse(67119) coiled-coil domain containing 159
Rat(300442) coiled-coil domain containing 159
sheep(101120327) coiled-coil domain containing 159
domestic guinea pig(100725336) coiled-coil domain containing 159
naked mole-rat(101708517) coiled-coil domain containing 159
dog(100688753) coiled-coil domain containing 159
cow(785202) coiled-coil domain containing 159
domestic cat(101081120) coiled-coil domain containing 159
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025977 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025977 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025977 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080503 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU075651 MISSION® esiRNA esiRNA targeting mouse 2510048L02Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080503 Rosetta Predictions human pricing
XM_496289 Rosetta Predictions human pricing
XM_934591 Rosetta Predictions human pricing
XM_934593 Rosetta Predictions human pricing
XM_934595 Rosetta Predictions human pricing
XM_934597 Rosetta Predictions human pricing
XM_934599 Rosetta Predictions human pricing
XM_934601 Rosetta Predictions human pricing
XM_934602 Rosetta Predictions human pricing
XM_934604 Rosetta Predictions human pricing
XM_934606 Rosetta Predictions human pricing
XM_934607 Rosetta Predictions human pricing
XM_934608 Rosetta Predictions human pricing
NM_001009667 Rosetta Predictions rat pricing
NM_025977 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315467 predicted 840
2 SASI_Hs02_00315468 predicted 1937
3 SASI_Hs02_00315469 predicted 1026
4 SASI_Hs02_00315470 predicted 1003
5 SASI_Hs02_00315471 predicted 1348
6 SASI_Hs02_00315472 predicted 1810
7 SASI_Hs02_00315473 predicted 1555
8 SASI_Hs02_00315474 predicted 954
9 SASI_Hs02_00315475 predicted 925
10 SASI_Hs02_00315476 predicted 1942
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00276614 predicted 845
2 SASI_Hs01_00276615 predicted 1933
3 SASI_Hs01_00276616 predicted 1034
4 SASI_Hs01_00276617 predicted 1006
5 SASI_Hs01_00276618 predicted 819
6 SASI_Hs01_00276619 predicted 1355
7 SASI_Hs01_00276620 predicted 650
8 SASI_Hs01_00276621 predicted 1806
9 SASI_Hs01_00276622 predicted 1556
10 SASI_Hs01_00276623 predicted 954
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934591 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259562 predicted 667
2 SASI_Hs01_00259563 predicted 235
3 SASI_Hs01_00259564 predicted 666
4 SASI_Hs01_00259565 predicted 543
5 SASI_Hs01_00259566 predicted 293
6 SASI_Hs01_00259567 predicted 649
7 SASI_Hs01_00259568 predicted 680
8 SASI_Hs01_00259569 predicted 677
9 SASI_Hs01_00259570 predicted 673
10 SASI_Hs01_00259571 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283744 predicted 844
2 SASI_Hs01_00283745 predicted 523
3 SASI_Hs01_00283746 predicted 854
4 SASI_Hs01_00283747 predicted 724
5 SASI_Hs01_00283748 predicted 455
6 SASI_Hs01_00283749 predicted 292
7 SASI_Hs01_00283750 predicted 828
8 SASI_Hs01_00283751 predicted 861
9 SASI_Hs01_00283752 predicted 861
10 SASI_Hs01_00283753 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293555 predicted 412
2 SASI_Hs01_00293556 predicted 253
3 SASI_Hs01_00293557 predicted 236
4 SASI_Hs01_00293558 predicted 255
5 SASI_Hs01_00293559 predicted 257
6 SASI_Hs01_00293560 predicted 410
7 SASI_Hs01_00293561 predicted 252
8 SASI_Hs01_00293562 predicted 224
9 SASI_Hs01_00293563 predicted 406
10 SASI_Hs01_00293564 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00256898 predicted 1009
2 SASI_Hs01_00256899 predicted 1334
3 SASI_Hs01_00256900 predicted 255
4 SASI_Hs01_00256901 predicted 229
5 SASI_Hs01_00256902 predicted 579
6 SASI_Hs01_00256903 predicted 1210
7 SASI_Hs01_00256904 predicted 248
8 SASI_Hs01_00256905 predicted 937
9 SASI_Hs01_00256906 predicted 787
10 SASI_Hs01_00256907 predicted 1353
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00268679 predicted 520
2 SASI_Hs01_00268680 predicted 291
3 SASI_Hs01_00268681 predicted 266
4 SASI_Hs01_00268682 predicted 787
5 SASI_Hs01_00268683 predicted 524
6 SASI_Hs01_00268684 predicted 285
7 SASI_Hs01_00268685 predicted 623
8 SASI_Hs01_00268686 predicted 221
9 SASI_Hs01_00268687 predicted 225
10 SASI_Hs01_00268688 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934601 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259247 predicted 487
2 SASI_Hs01_00259248 predicted 258
3 SASI_Hs01_00259249 predicted 227
4 SASI_Hs01_00259250 predicted 756
5 SASI_Hs01_00259251 predicted 482
6 SASI_Hs01_00259252 predicted 247
7 SASI_Hs01_00259253 predicted 585
8 SASI_Hs01_00259254 predicted 283
9 SASI_Hs01_00259255 predicted 594
10 SASI_Hs01_00259256 predicted 550
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934602 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291194 predicted 736
2 SASI_Hs01_00291195 predicted 1067
3 SASI_Hs01_00291196 predicted 259
4 SASI_Hs01_00291197 predicted 233
5 SASI_Hs01_00291198 predicted 313
6 SASI_Hs01_00291199 predicted 944
7 SASI_Hs01_00291200 predicted 250
8 SASI_Hs01_00291201 predicted 678
9 SASI_Hs01_00291202 predicted 511
10 SASI_Hs01_00291203 predicted 1085
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251890 predicted 868
2 SASI_Hs01_00251891 predicted 520
3 SASI_Hs01_00251892 predicted 352
4 SASI_Hs01_00251893 predicted 624
5 SASI_Hs01_00251894 predicted 773
6 SASI_Hs01_00251895 predicted 352
7 SASI_Hs01_00251896 predicted 200
8 SASI_Hs01_00251897 predicted 104
9 SASI_Hs01_00251898 predicted 359
10 SASI_Hs01_00251899 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934606 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00252556 predicted 295
2 SASI_Hs01_00252557 predicted 273
3 SASI_Hs01_00252558 predicted 620
4 SASI_Hs01_00252559 predicted 1287
5 SASI_Hs01_00252560 predicted 936
6 SASI_Hs01_00252561 predicted 777
7 SASI_Hs01_00252562 predicted 1042
8 SASI_Hs01_00252563 predicted 215
9 SASI_Hs01_00252564 predicted 226
10 SASI_Hs01_00252565 predicted 1182
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248171 predicted 1225
2 SASI_Hs01_00248172 predicted 324
3 SASI_Hs01_00248173 predicted 295
4 SASI_Hs01_00248174 predicted 637
5 SASI_Hs01_00248175 predicted 1099
6 SASI_Hs01_00248176 predicted 312
7 SASI_Hs01_00248177 predicted 845
8 SASI_Hs01_00248178 predicted 248
9 SASI_Hs01_00248179 predicted 216
10 SASI_Hs01_00248180 predicted 1235
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934608 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296995 predicted 1204
2 SASI_Hs01_00296996 predicted 299
3 SASI_Hs01_00296997 predicted 268
4 SASI_Hs01_00296998 predicted 612
5 SASI_Hs01_00296999 predicted 1065
6 SASI_Hs01_00297000 predicted 291
7 SASI_Hs01_00297001 predicted 818
8 SASI_Hs01_00297002 predicted 215
9 SASI_Hs01_00297003 predicted 1204
10 SASI_Hs01_00297004 predicted 1207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009667 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199699 predicted 597
2 SASI_Rn02_00199700 predicted 542
3 SASI_Rn01_00051961 predicted 779
4 SASI_Rn01_00051962 predicted 287
5 SASI_Rn02_00199701 predicted 219
6 SASI_Rn01_00051964 predicted 391
7 SASI_Rn01_00051966 predicted 746
8 SASI_Rn01_00051967 predicted 670
9 SASI_Rn01_00051968 predicted 623
10 SASI_Rn01_00051969 predicted 493
11 SASI_Rn01_00051963 predicted 244
12 SASI_Rn01_00051965 predicted 686
13 SASI_Rn01_00051970 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025977 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060737 predicted 290
2 SASI_Mm01_00060738 predicted 1134
3 SASI_Mm01_00060739 predicted 648
4 SASI_Mm01_00060740 predicted 550
5 SASI_Mm01_00060741 predicted 403
6 SASI_Mm01_00060742 predicted 528
7 SASI_Mm01_00060743 predicted 1278
8 SASI_Mm01_00060744 predicted 1293
9 SASI_Mm01_00060745 predicted 597
10 SASI_Mm02_00329399 predicted 1235
11 SASI_Mm01_00060746 predicted 1009
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025977
CCDC159 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 159
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025977.2-1098s21c1
Sequence:CCGGTCTCAGAGAATCTCCTGAATACTCGAGTATTCAGGAGATTCTCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025977.2-558s21c1
Sequence:CCGGACGTGAACAAGGACCATTATCCTCGAGGATAATGGTCCTTGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025977.2-1304s1c1
Sequence:CCGGGACTGTCTTGCTTTGTCAATGCTCGAGCATTGACAAAGCAAGACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025977.2-792s21c1
Sequence:CCGGGCCTACAGCAGATCAAGATTCCTCGAGGAATCTTGATCTGCTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025977.2-1056s21c1
Sequence:CCGGTGACTTTCATCTATCAGAAACCTCGAGGTTTCTGATAGATGAAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025977.2-652s21c1
Sequence:CCGGAGTTAAGAACACCATGATAATCTCGAGATTATCATGGTGTTCTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025977.1-558s1c1
Sequence:CCGGGACGTGAACAAGGACCATTATCTCGAGATAATGGTCCTTGTTCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025977.1-602s1c1
Sequence:CCGGGAACCACTGTGTAGCCAAGAACTCGAGTTCTTGGCTACACAGTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025977
CCDC159 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 159
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025977.2-1098s21c1
Sequence:CCGGTCTCAGAGAATCTCCTGAATACTCGAGTATTCAGGAGATTCTCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025977.2-558s21c1
Sequence:CCGGACGTGAACAAGGACCATTATCCTCGAGGATAATGGTCCTTGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025977.2-1304s1c1
Sequence:CCGGGACTGTCTTGCTTTGTCAATGCTCGAGCATTGACAAAGCAAGACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025977.2-792s21c1
Sequence:CCGGGCCTACAGCAGATCAAGATTCCTCGAGGAATCTTGATCTGCTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025977.2-1056s21c1
Sequence:CCGGTGACTTTCATCTATCAGAAACCTCGAGGTTTCTGATAGATGAAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025977.2-652s21c1
Sequence:CCGGAGTTAAGAACACCATGATAATCTCGAGATTATCATGGTGTTCTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025977.1-558s1c1
Sequence:CCGGGACGTGAACAAGGACCATTATCTCGAGATAATGGTCCTTGTTCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025977.1-602s1c1
Sequence:CCGGGAACCACTGTGTAGCCAAGAACTCGAGTTCTTGGCTACACAGTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025977
CCDC159 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 159
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025977.2-1098s21c1
Sequence:CCGGTCTCAGAGAATCTCCTGAATACTCGAGTATTCAGGAGATTCTCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025977.2-558s21c1
Sequence:CCGGACGTGAACAAGGACCATTATCCTCGAGGATAATGGTCCTTGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025977.2-1304s1c1
Sequence:CCGGGACTGTCTTGCTTTGTCAATGCTCGAGCATTGACAAAGCAAGACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025977.2-792s21c1
Sequence:CCGGGCCTACAGCAGATCAAGATTCCTCGAGGAATCTTGATCTGCTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025977.2-1056s21c1
Sequence:CCGGTGACTTTCATCTATCAGAAACCTCGAGGTTTCTGATAGATGAAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025977.2-652s21c1
Sequence:CCGGAGTTAAGAACACCATGATAATCTCGAGATTATCATGGTGTTCTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025977.1-558s1c1
Sequence:CCGGGACGTGAACAAGGACCATTATCTCGAGATAATGGTCCTTGTTCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025977.1-602s1c1
Sequence:CCGGGAACCACTGTGTAGCCAAGAACTCGAGTTCTTGGCTACACAGTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080503
CCDC159 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 159
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080503.2-158s21c1
Sequence:CCGGCCAAGACCATTGTGATGATTCCTCGAGGAATCATCACAATGGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080503.2-296s21c1
Sequence:CCGGGCTTGCAGCAAATCAAGATTCCTCGAGGAATCTTGATTTGCTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080503.2-770s21c1
Sequence:CCGGAGAAGGAACTGAGTGATATATCTCGAGATATATCACTCAGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080503.2-563s21c1
Sequence:CCGGAGGAGGTGACCTTCATCTATCCTCGAGGATAGATGAAGGTCACCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080503.2-817s21c1
Sequence:CCGGTCCATAGACAGCCTCACTTTGCTCGAGCAAAGTGAGGCTGTCTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080503
CCDC159 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 159
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080503.2-158s21c1
Sequence:CCGGCCAAGACCATTGTGATGATTCCTCGAGGAATCATCACAATGGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080503.2-296s21c1
Sequence:CCGGGCTTGCAGCAAATCAAGATTCCTCGAGGAATCTTGATTTGCTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080503.2-770s21c1
Sequence:CCGGAGAAGGAACTGAGTGATATATCTCGAGATATATCACTCAGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080503.2-563s21c1
Sequence:CCGGAGGAGGTGACCTTCATCTATCCTCGAGGATAGATGAAGGTCACCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080503.2-817s21c1
Sequence:CCGGTCCATAGACAGCCTCACTTTGCTCGAGCAAAGTGAGGCTGTCTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080503
CCDC159 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 159
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080503.2-158s21c1
Sequence:CCGGCCAAGACCATTGTGATGATTCCTCGAGGAATCATCACAATGGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080503.2-296s21c1
Sequence:CCGGGCTTGCAGCAAATCAAGATTCCTCGAGGAATCTTGATTTGCTGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080503.2-770s21c1
Sequence:CCGGAGAAGGAACTGAGTGATATATCTCGAGATATATCACTCAGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080503.2-563s21c1
Sequence:CCGGAGGAGGTGACCTTCATCTATCCTCGAGGATAGATGAAGGTCACCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080503.2-817s21c1
Sequence:CCGGTCCATAGACAGCCTCACTTTGCTCGAGCAAAGTGAGGCTGTCTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks