EMAIL THIS PAGE TO A FRIEND

CCDC160

coiled-coil domain containing 160

49 Gene Product Result for
UniProtKB ID: A6NGH7
Gene ID:
Mouse(434778) coiled-coil domain containing 160
Rat(683891) coiled-coil domain containing 160
dog(611703) coiled-coil domain-containing protein 160-like
domestic cat(101087387) coiled-coil domain containing 160
cow(767883) coiled-coil domain containing 160
domestic guinea pig(100727077) coiled-coil domain containing 160
sheep(101108991) coiled-coil domain containing 160
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001034059 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001034059 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001034059 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001101357 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001101357 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001101357 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU217911 MISSION® esiRNA esiRNA targeting human CCDC160 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101357 Rosetta Predictions human pricing
XM_001061394 Rosetta Predictions rat pricing
XM_001061452 Rosetta Predictions rat pricing
NM_001034059 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322695 predicted 486
2 SASI_Hs02_00322696 predicted 689
3 SASI_Hs02_00322697 predicted 431
4 SASI_Hs02_00322698 predicted 782
5 SASI_Hs02_00322699 predicted 626
6 SASI_Hs02_00322700 predicted 1059
7 SASI_Hs02_00322701 predicted 655
8 SASI_Hs02_00322702 predicted 399
9 SASI_Hs02_00322703 predicted 605
10 SASI_Hs02_00322704 predicted 924
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061394 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00299897 predicted 396
2 SASI_Rn02_00299898 predicted 824
3 SASI_Rn02_00299899 predicted 858
4 SASI_Rn02_00299900 predicted 628
5 SASI_Rn02_00299901 predicted 1144
6 SASI_Rn02_00299902 predicted 878
7 SASI_Rn02_00299903 predicted 1176
8 SASI_Rn02_00299904 predicted 375
9 SASI_Rn02_00299905 predicted 260
10 SASI_Rn02_00299906 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061452 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300134 predicted 449
2 SASI_Rn02_00300135 predicted 879
3 SASI_Rn02_00300136 predicted 923
4 SASI_Rn02_00300137 predicted 366
5 SASI_Rn02_00300138 predicted 685
6 SASI_Rn02_00300139 predicted 298
7 SASI_Rn02_00300140 predicted 940
8 SASI_Rn02_00300141 predicted 460
9 SASI_Rn02_00300142 predicted 368
10 SASI_Rn02_00300143 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034059 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072384 predicted 279
2 SASI_Mm01_00072385 predicted 364
3 SASI_Mm01_00072386 predicted 336
4 SASI_Mm01_00072387 predicted 400
5 SASI_Mm01_00072388 predicted 917
6 SASI_Mm01_00072389 predicted 1081
7 SASI_Mm01_00072390 predicted 388
8 SASI_Mm01_00072391 predicted 512
9 SASI_Mm01_00072392 predicted 626
10 SASI_Mm01_00072393 predicted 888
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034059
CCDC160 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 160
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000283871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034059.1-414s21c1
Sequence:CCGGGAATGATGCAAATACCAATTCCTCGAGGAATTGGTATTTGCATCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034059.1-1209s21c1
Sequence:CCGGATGTATTTGAAAGCGTGTAATCTCGAGATTACACGCTTTCAAATACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034059.1-1069s21c1
Sequence:CCGGTCAGTGGTAAGGTCGTCAAATCTCGAGATTTGACGACCTTACCACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034059.1-893s21c1
Sequence:CCGGAGCATCAAACTGAACTAAATACTCGAGTATTTAGTTCAGTTTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034059
CCDC160 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 160
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000283871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034059.1-414s21c1
Sequence:CCGGGAATGATGCAAATACCAATTCCTCGAGGAATTGGTATTTGCATCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034059.1-1209s21c1
Sequence:CCGGATGTATTTGAAAGCGTGTAATCTCGAGATTACACGCTTTCAAATACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034059.1-1069s21c1
Sequence:CCGGTCAGTGGTAAGGTCGTCAAATCTCGAGATTTGACGACCTTACCACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034059.1-893s21c1
Sequence:CCGGAGCATCAAACTGAACTAAATACTCGAGTATTTAGTTCAGTTTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034059
CCDC160 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 160
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000283871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034059.1-414s21c1
Sequence:CCGGGAATGATGCAAATACCAATTCCTCGAGGAATTGGTATTTGCATCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001034059.1-1209s21c1
Sequence:CCGGATGTATTTGAAAGCGTGTAATCTCGAGATTACACGCTTTCAAATACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034059.1-1069s21c1
Sequence:CCGGTCAGTGGTAAGGTCGTCAAATCTCGAGATTTGACGACCTTACCACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034059.1-893s21c1
Sequence:CCGGAGCATCAAACTGAACTAAATACTCGAGTATTTAGTTCAGTTTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101357
CCDC160 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 160
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101357.1-921s21c1
Sequence:CCGGCTATGAACTTCAAGCTTTAAGCTCGAGCTTAAAGCTTGAAGTTCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101357.1-607s21c1
Sequence:CCGGGCATCCTATGAATCATCTAATCTCGAGATTAGATGATTCATAGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101357.1-1047s21c1
Sequence:CCGGAGAAGCTGTTAGGAAGTTAAACTCGAGTTTAACTTCCTAACAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101357.1-690s21c1
Sequence:CCGGTAACTTACCAGCTCTACTAAGCTCGAGCTTAGTAGAGCTGGTAAGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101357.1-1025s21c1
Sequence:CCGGACCTAGAGAACAGAAATTTAACTCGAGTTAAATTTCTGTTCTCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101357
CCDC160 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 160
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101357.1-921s21c1
Sequence:CCGGCTATGAACTTCAAGCTTTAAGCTCGAGCTTAAAGCTTGAAGTTCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101357.1-607s21c1
Sequence:CCGGGCATCCTATGAATCATCTAATCTCGAGATTAGATGATTCATAGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101357.1-1047s21c1
Sequence:CCGGAGAAGCTGTTAGGAAGTTAAACTCGAGTTTAACTTCCTAACAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101357.1-690s21c1
Sequence:CCGGTAACTTACCAGCTCTACTAAGCTCGAGCTTAGTAGAGCTGGTAAGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101357.1-1025s21c1
Sequence:CCGGACCTAGAGAACAGAAATTTAACTCGAGTTAAATTTCTGTTCTCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101357
CCDC160 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 160
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101357.1-921s21c1
Sequence:CCGGCTATGAACTTCAAGCTTTAAGCTCGAGCTTAAAGCTTGAAGTTCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101357.1-607s21c1
Sequence:CCGGGCATCCTATGAATCATCTAATCTCGAGATTAGATGATTCATAGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101357.1-1047s21c1
Sequence:CCGGAGAAGCTGTTAGGAAGTTAAACTCGAGTTTAACTTCCTAACAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101357.1-690s21c1
Sequence:CCGGTAACTTACCAGCTCTACTAAGCTCGAGCTTAGTAGAGCTGGTAAGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101357.1-1025s21c1
Sequence:CCGGACCTAGAGAACAGAAATTTAACTCGAGTTAAATTTCTGTTCTCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)