EMAIL THIS PAGE TO A FRIEND

CCDC163P

coiled-coil domain containing 163, pseudogene

50 Gene Product Result for
Synonyms: C1orf231
Species: Human CCDC163P(126661)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001102601 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001102601 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001102601 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102601 Rosetta Predictions human pricing
XM_059061 Rosetta Predictions human pricing
XM_934307 Rosetta Predictions human pricing
XM_934312 Rosetta Predictions human pricing
XM_934315 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102601 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323360 predicted 668
2 SASI_Hs02_00323361 predicted 475
3 SASI_Hs02_00323362 predicted 693
4 SASI_Hs02_00323363 predicted 412
5 SASI_Hs02_00323364 predicted 425
6 SASI_Hs02_00323365 predicted 431
7 SASI_Hs02_00323366 predicted 484
8 SASI_Hs02_00323367 predicted 406
9 SASI_Hs02_00323368 predicted 391
10 SASI_Hs02_00323369 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_059061 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00254408 predicted 918
2 SASI_Hs01_00254409 predicted 869
3 SASI_Hs01_00254410 predicted 792
4 SASI_Hs01_00254411 predicted 561
5 SASI_Hs01_00254412 predicted 820
6 SASI_Hs01_00254413 predicted 857
7 SASI_Hs01_00254414 predicted 504
8 SASI_Hs01_00254415 predicted 788
9 SASI_Hs01_00254416 predicted 525
10 SASI_Hs01_00254417 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934307 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261392 predicted 535
2 SASI_Hs01_00261393 predicted 767
3 SASI_Hs01_00261394 predicted 551
4 SASI_Hs01_00261395 predicted 485
5 SASI_Hs01_00261396 predicted 496
6 SASI_Hs01_00261397 predicted 501
7 SASI_Hs01_00261398 predicted 550
8 SASI_Hs01_00261399 predicted 473
9 SASI_Hs01_00261400 predicted 466
10 SASI_Hs01_00261401 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259075 predicted 468
2 SASI_Hs01_00259076 predicted 420
3 SASI_Hs01_00259077 predicted 510
4 SASI_Hs01_00259078 predicted 335
5 SASI_Hs01_00259079 predicted 322
6 SASI_Hs01_00259080 predicted 371
7 SASI_Hs01_00259081 predicted 405
8 SASI_Hs01_00259082 predicted 340
9 SASI_Hs01_00259083 predicted 333
10 SASI_Hs01_00259084 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00284409 predicted 837
2 SASI_Hs01_00284410 predicted 786
3 SASI_Hs01_00284411 predicted 703
4 SASI_Hs01_00284412 predicted 566
5 SASI_Hs01_00284413 predicted 740
6 SASI_Hs01_00284414 predicted 769
7 SASI_Hs01_00284415 predicted 509
8 SASI_Hs01_00284416 predicted 699
9 SASI_Hs01_00284417 predicted 524
10 SASI_Hs01_00284418 predicted 703
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001102601
VALIDATED
CCDC163P MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 163, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102601.1-501s21c1
Sequence:CCGGTTCTGTAGCAGTGGCTGTATCCTCGAGGATACAGCCACTGCTACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_001102601.1-421s21c1
Sequence:CCGGATGGAAATGTGGTCCGGAATACTCGAGTATTCCGGACCACATTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001102601.1-701s21c1
Sequence:CCGGCAGAGGAGCACCCTTTCTAACCTCGAGGTTAGAAAGGGTGCTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_001102601.1-758s21c1
Sequence:CCGGCTTAAGCAAGAGGACCTATTCCTCGAGGAATAGGTCCTCTTGCTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102601.1-607s21c1
Sequence:CCGGAGTTGCTGCAGTACCAGTTGACTCGAGTCAACTGGTACTGCAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001102601
VALIDATED
CCDC163P MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 163, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102601.1-501s21c1
Sequence:CCGGTTCTGTAGCAGTGGCTGTATCCTCGAGGATACAGCCACTGCTACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_001102601.1-421s21c1
Sequence:CCGGATGGAAATGTGGTCCGGAATACTCGAGTATTCCGGACCACATTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001102601.1-701s21c1
Sequence:CCGGCAGAGGAGCACCCTTTCTAACCTCGAGGTTAGAAAGGGTGCTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_001102601.1-758s21c1
Sequence:CCGGCTTAAGCAAGAGGACCTATTCCTCGAGGAATAGGTCCTCTTGCTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102601.1-607s21c1
Sequence:CCGGAGTTGCTGCAGTACCAGTTGACTCGAGTCAACTGGTACTGCAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001102601
VALIDATED
CCDC163P MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 163, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102601.1-501s21c1
Sequence:CCGGTTCTGTAGCAGTGGCTGTATCCTCGAGGATACAGCCACTGCTACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_001102601.1-421s21c1
Sequence:CCGGATGGAAATGTGGTCCGGAATACTCGAGTATTCCGGACCACATTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001102601.1-701s21c1
Sequence:CCGGCAGAGGAGCACCCTTTCTAACCTCGAGGTTAGAAAGGGTGCTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_001102601.1-758s21c1
Sequence:CCGGCTTAAGCAAGAGGACCTATTCCTCGAGGAATAGGTCCTCTTGCTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102601.1-607s21c1
Sequence:CCGGAGTTGCTGCAGTACCAGTTGACTCGAGTCAACTGGTACTGCAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks