EMAIL THIS PAGE TO A FRIEND

CCDC166

coiled-coil domain containing 166

78 Gene Product Result for
UniProtKB ID: P0CW27
Gene ID:
Mouse(223648) coiled-coil domain containing 166
Rat(680799) coiled-coil domain containing 166
cow(100138046) coiled-coil domain containing 166
sheep(101112490) coiled-coil domain containing 166
domestic guinea pig(100731080) coiled-coil domain containing 166
naked mole-rat(101717241) coiled-coil domain containing 166
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146059 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146059 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146059 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714012 Rosetta Predictions human pricing
XM_001714476 Rosetta Predictions human pricing
XM_001715033 Rosetta Predictions human pricing
NM_001130509 Rosetta Predictions rat pricing
NM_146059 Rosetta Predictions mouse pricing
XR_035296 Rosetta Predictions mouse pricing
XR_035335 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714012 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00394375 predicted 1053
2 SASI_Hs02_00394376 predicted 1033
3 SASI_Hs02_00394377 predicted 1031
4 SASI_Hs02_00394378 predicted 1060
5 SASI_Hs02_00394379 predicted 1036
6 SASI_Hs02_00394380 predicted 962
7 SASI_Hs02_00394381 predicted 1037
8 SASI_Hs02_00394382 predicted 1031
9 SASI_Hs02_00394383 predicted 1174
10 SASI_Hs02_00394384 predicted 91
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00397371 predicted 1034
2 SASI_Hs02_00397372 predicted 323
3 SASI_Hs02_00397373 predicted 319
4 SASI_Hs02_00397374 predicted 213
5 SASI_Hs02_00397375 predicted 244
6 SASI_Hs02_00397376 predicted 215
7 SASI_Hs02_00397377 predicted 240
8 SASI_Hs02_00397378 predicted 291
9 SASI_Hs02_00397379 predicted 1035
10 SASI_Hs02_00397380 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715033 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00401054 predicted 625
2 SASI_Hs02_00401055 predicted 494
3 SASI_Hs02_00401056 predicted 799
4 SASI_Hs02_00401057 predicted 1743
5 SASI_Hs02_00401058 predicted 794
6 SASI_Hs02_00401059 predicted 929
7 SASI_Hs02_00401060 predicted 649
8 SASI_Hs02_00401061 predicted 929
9 SASI_Hs02_00401062 predicted 382
10 SASI_Hs02_00401063 predicted 782
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130509 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255519 predicted 413
2 SASI_Rn02_00255520 predicted 289
3 SASI_Rn02_00255521 predicted 287
4 SASI_Rn02_00255522 predicted 815
5 SASI_Rn02_00255523 predicted 655
6 SASI_Rn02_00255524 predicted 750
7 SASI_Rn02_00255525 predicted 815
8 SASI_Rn02_00255526 predicted 831
9 SASI_Rn02_00255527 predicted 781
10 SASI_Rn02_00255528 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146059 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149480 predicted 393
2 SASI_Mm01_00149481 predicted 764
3 SASI_Mm01_00149482 predicted 644
4 SASI_Mm01_00149483 predicted 710
5 SASI_Mm01_00149484 predicted 996
6 SASI_Mm01_00149485 predicted 811
7 SASI_Mm01_00149486 predicted 840
8 SASI_Mm01_00149487 predicted 447
9 SASI_Mm01_00149488 predicted 758
10 SASI_Mm01_00149489 predicted 824
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035296 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00481370 predicted 468
2 SASI_Mm02_00481371 predicted 266
3 SASI_Mm02_00481372 predicted 205
4 SASI_Mm02_00481373 predicted 1333
5 SASI_Mm02_00481374 predicted 562
6 SASI_Mm02_00481375 predicted 203
7 SASI_Mm02_00481376 predicted 263
8 SASI_Mm02_00481377 predicted 302
9 SASI_Mm02_00481378 predicted 268
10 SASI_Mm02_00481379 predicted 1374
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035335 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00481745 predicted 470
2 SASI_Mm02_00481746 predicted 265
3 SASI_Mm02_00481747 predicted 207
4 SASI_Mm02_00481748 predicted 1334
5 SASI_Mm02_00481749 predicted 561
6 SASI_Mm02_00481750 predicted 203
7 SASI_Mm02_00481751 predicted 267
8 SASI_Mm02_00481752 predicted 307
9 SASI_Mm02_00481753 predicted 274
10 SASI_Mm02_00481754 predicted 1365
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146059
CCDC166 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 166
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146059.1-311s1c1
Sequence:CCGGCCTAGATGAGAAGACGGCTTTCTCGAGAAAGCCGTCTTCTCATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146059.1-707s1c1
Sequence:CCGGCCAATCCATGGATCTGTCACACTCGAGTGTGACAGATCCATGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146059.1-835s1c1
Sequence:CCGGGAGTCTCATCTCTGACTCCATCTCGAGATGGAGTCAGAGATGAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146059.1-437s1c1
Sequence:CCGGGTATCTCCGACAAGAACTCATCTCGAGATGAGTTCTTGTCGGAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146059
CCDC166 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 166
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146059.1-311s1c1
Sequence:CCGGCCTAGATGAGAAGACGGCTTTCTCGAGAAAGCCGTCTTCTCATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146059.1-707s1c1
Sequence:CCGGCCAATCCATGGATCTGTCACACTCGAGTGTGACAGATCCATGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146059.1-835s1c1
Sequence:CCGGGAGTCTCATCTCTGACTCCATCTCGAGATGGAGTCAGAGATGAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146059.1-437s1c1
Sequence:CCGGGTATCTCCGACAAGAACTCATCTCGAGATGAGTTCTTGTCGGAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146059
CCDC166 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 166
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146059.1-311s1c1
Sequence:CCGGCCTAGATGAGAAGACGGCTTTCTCGAGAAAGCCGTCTTCTCATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146059.1-707s1c1
Sequence:CCGGCCAATCCATGGATCTGTCACACTCGAGTGTGACAGATCCATGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146059.1-835s1c1
Sequence:CCGGGAGTCTCATCTCTGACTCCATCTCGAGATGGAGTCAGAGATGAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146059.1-437s1c1
Sequence:CCGGGTATCTCCGACAAGAACTCATCTCGAGATGAGTTCTTGTCGGAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks