EMAIL THIS PAGE TO A FRIEND

CCDC167

coiled-coil domain containing 167

36 Gene Product Result for
Synonyms: C6orf129 HSPC265
UniProtKB ID: Q9P0B6, Q5T7F7, Q9BTQ9
Gene ID:
Mouse(68597) coiled-coil domain containing 167
Rat(689755) coiled-coil domain containing 167
naked mole-rat(101703006) coiled-coil domain containing 167
domestic guinea pig(101787228) coiled-coil domain containing 167
sheep(101123505) coiled-coil domain containing 167
chicken(421433) coiled-coil domain containing 167
domestic cat(101083172) coiled-coil domain containing 167
dog(608596) coiled-coil domain containing 167
cow(507353) coiled-coil domain containing 167
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138493 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138493 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138493 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138493 Rosetta Predictions human pricing
NM_001109548 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035886 predicted 238
2 SASI_Hs01_00035887 predicted 234
3 SASI_Hs01_00035888 predicted 325
4 SASI_Hs01_00035889 predicted 296
5 SASI_Hs01_00035890 predicted 274
6 SASI_Hs01_00035891 predicted 270
7 SASI_Hs01_00035892 predicted 246
8 SASI_Hs01_00035893 predicted 254
9 SASI_Hs01_00035894 predicted 315
10 SASI_Hs02_00363685 predicted 299
11 SASI_Hs01_00035895 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109548 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249479 predicted 213
2 SASI_Rn02_00249480 predicted 252
3 SASI_Rn02_00249481 predicted 198
4 SASI_Rn02_00249482 predicted 196
5 SASI_Rn02_00249483 predicted 213
6 SASI_Rn02_00249484 predicted 224
7 SASI_Rn02_00249485 predicted 210
8 SASI_Rn02_00249486 predicted 208
9 SASI_Rn02_00249487 predicted 213
10 SASI_Rn02_00249488 predicted 236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138493
VALIDATED
CCDC167 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 167
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138493.1-256s1c1
Sequence:CCGGGAACTGAAGTTTCTTCGGCAACTCGAGTTGCCGAAGAAACTTCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_138493.1-261s1c1
Sequence:CCGGGAAGTTTCTTCGGCAAGAGAACTCGAGTTCTCTTGCCGAAGAAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138493.1-246s1c1
Sequence:CCGGCTACGAGAAGGAACTGAAGTTCTCGAGAACTTCAGTTCCTTCTCGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138493.1-273s1c1
Sequence:CCGGGCAAGAGAACCGGAAGAACATCTCGAGATGTTCTTCCGGTTCTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_138493.1-466s1c1
Sequence:CCGGCCTAGTGTTCAAGCATGGCTTCTCGAGAAGCCATGCTTGAACACTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_138493.1-243s1c1
Sequence:CCGGCAACTACGAGAAGGAACTGAACTCGAGTTCAGTTCCTTCTCGTAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_138493.1-94s1c1
Sequence:CCGGGCTCTAGAGATCGATGGGTTACTCGAGTAACCCATCGATCTCTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_138493.1-224s1c1
Sequence:CCGGGCCTAATGAACAAAGCCTCCACTCGAGTGGAGGCTTTGTTCATTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138493.2-347s21c1
Sequence:CCGGACCATGTGAGCCTGGCACTTCCTCGAGGAAGTGCCAGGCTCACATGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138493
VALIDATED
CCDC167 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 167
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138493.1-256s1c1
Sequence:CCGGGAACTGAAGTTTCTTCGGCAACTCGAGTTGCCGAAGAAACTTCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_138493.1-261s1c1
Sequence:CCGGGAAGTTTCTTCGGCAAGAGAACTCGAGTTCTCTTGCCGAAGAAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138493.1-246s1c1
Sequence:CCGGCTACGAGAAGGAACTGAAGTTCTCGAGAACTTCAGTTCCTTCTCGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138493.1-273s1c1
Sequence:CCGGGCAAGAGAACCGGAAGAACATCTCGAGATGTTCTTCCGGTTCTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_138493.1-466s1c1
Sequence:CCGGCCTAGTGTTCAAGCATGGCTTCTCGAGAAGCCATGCTTGAACACTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_138493.1-243s1c1
Sequence:CCGGCAACTACGAGAAGGAACTGAACTCGAGTTCAGTTCCTTCTCGTAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_138493.1-94s1c1
Sequence:CCGGGCTCTAGAGATCGATGGGTTACTCGAGTAACCCATCGATCTCTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_138493.1-224s1c1
Sequence:CCGGGCCTAATGAACAAAGCCTCCACTCGAGTGGAGGCTTTGTTCATTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138493.2-347s21c1
Sequence:CCGGACCATGTGAGCCTGGCACTTCCTCGAGGAAGTGCCAGGCTCACATGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138493
VALIDATED
CCDC167 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 167
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138493.1-256s1c1
Sequence:CCGGGAACTGAAGTTTCTTCGGCAACTCGAGTTGCCGAAGAAACTTCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_138493.1-261s1c1
Sequence:CCGGGAAGTTTCTTCGGCAAGAGAACTCGAGTTCTCTTGCCGAAGAAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138493.1-246s1c1
Sequence:CCGGCTACGAGAAGGAACTGAAGTTCTCGAGAACTTCAGTTCCTTCTCGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138493.1-273s1c1
Sequence:CCGGGCAAGAGAACCGGAAGAACATCTCGAGATGTTCTTCCGGTTCTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_138493.1-466s1c1
Sequence:CCGGCCTAGTGTTCAAGCATGGCTTCTCGAGAAGCCATGCTTGAACACTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_138493.1-243s1c1
Sequence:CCGGCAACTACGAGAAGGAACTGAACTCGAGTTCAGTTCCTTCTCGTAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_138493.1-94s1c1
Sequence:CCGGGCTCTAGAGATCGATGGGTTACTCGAGTAACCCATCGATCTCTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_138493.1-224s1c1
Sequence:CCGGGCCTAATGAACAAAGCCTCCACTCGAGTGGAGGCTTTGTTCATTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138493.2-347s21c1
Sequence:CCGGACCATGTGAGCCTGGCACTTCCTCGAGGAAGTGCCAGGCTCACATGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)