EMAIL THIS PAGE TO A FRIEND

CCDC168

coiled-coil domain containing 168

Synonyms: C13orf40
UniProtKB ID: Q8NDH2, Q8N800
Gene ID:
cow(101906427) coiled-coil domain containing 168
cow(100298796) coiled-coil domain containing 168
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001146197 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001146197 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001146197 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714647 Rosetta Predictions human pricing
XM_062871 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00398486 predicted 15581
2 SASI_Hs02_00398487 predicted 12234
3 SASI_Hs02_00398488 predicted 6752
4 SASI_Hs02_00398489 predicted 9243
5 SASI_Hs02_00398490 predicted 2842
6 SASI_Hs02_00398491 predicted 663
7 SASI_Hs02_00398492 predicted 5189
8 SASI_Hs02_00398493 predicted 565
9 SASI_Hs02_00398494 predicted 12183
10 SASI_Hs02_00398495 predicted 7920
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_062871 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269333 predicted 8400
2 SASI_Hs01_00269334 predicted 9070
3 SASI_Hs01_00269335 predicted 403
4 SASI_Hs01_00269336 predicted 9166
5 SASI_Hs01_00269337 predicted 8209
6 SASI_Hs01_00269338 predicted 8524
7 SASI_Hs01_00269339 predicted 431
8 SASI_Hs01_00269340 predicted 8879
9 SASI_Hs01_00269341 predicted 8334
10 SASI_Hs01_00269342 predicted 9151
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001146197
CCDC168 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 168
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146197.1-840s21c1
Sequence:CCGGTGCCCTCTTGCCCACTTATTTCTCGAGAAATAAGTGGGCAAGAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146197.1-11444s21c1
Sequence:CCGGATCATCTGCAGAGTCAATTAACTCGAGTTAATTGACTCTGCAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146197.1-17959s21c1
Sequence:CCGGCAGACGCAAACACCAATATAACTCGAGTTATATTGGTGTTTGCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146197.1-10418s21c1
Sequence:CCGGATTATCAGAAGGAGGTAATTTCTCGAGAAATTACCTCCTTCTGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146197.1-9604s21c1
Sequence:CCGGAGCAATCAAAGTTGGATATTACTCGAGTAATATCCAACTTTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001146197
CCDC168 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 168
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146197.1-840s21c1
Sequence:CCGGTGCCCTCTTGCCCACTTATTTCTCGAGAAATAAGTGGGCAAGAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146197.1-11444s21c1
Sequence:CCGGATCATCTGCAGAGTCAATTAACTCGAGTTAATTGACTCTGCAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146197.1-17959s21c1
Sequence:CCGGCAGACGCAAACACCAATATAACTCGAGTTATATTGGTGTTTGCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146197.1-10418s21c1
Sequence:CCGGATTATCAGAAGGAGGTAATTTCTCGAGAAATTACCTCCTTCTGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146197.1-9604s21c1
Sequence:CCGGAGCAATCAAAGTTGGATATTACTCGAGTAATATCCAACTTTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001146197
CCDC168 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 168
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146197.1-840s21c1
Sequence:CCGGTGCCCTCTTGCCCACTTATTTCTCGAGAAATAAGTGGGCAAGAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146197.1-11444s21c1
Sequence:CCGGATCATCTGCAGAGTCAATTAACTCGAGTTAATTGACTCTGCAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146197.1-17959s21c1
Sequence:CCGGCAGACGCAAACACCAATATAACTCGAGTTATATTGGTGTTTGCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146197.1-10418s21c1
Sequence:CCGGATTATCAGAAGGAGGTAATTTCTCGAGAAATTACCTCCTTCTGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146197.1-9604s21c1
Sequence:CCGGAGCAATCAAAGTTGGATATTACTCGAGTAATATCCAACTTTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks