EMAIL THIS PAGE TO A FRIEND

CCDC169

coiled-coil domain containing 169

61 Gene Product Result for
Synonyms: C13orf38
Gene ID:
Mouse(320604) coiled-coil domain containing 169
Rat(499618) coiled-coil domain containing 169
Zebrafish(559748) coiled-coil domain containing 169
chicken(101669609) coiled-coil domain containing 169
chicken(101751930) coiled-coil domain containing 169
cow(100294797) coiled-coil domain containing 169
chicken(770949) coiled-coil domain containing 169
naked mole-rat(101721386) coiled-coil domain containing 169
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301629 ANTI-C13ORF38 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001144986 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001144986 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001144986 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177203 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177203 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177203 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU002451 MISSION® esiRNA esiRNA targeting mouse A730037C10Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001130109 Rosetta Predictions human pricing
XM_001133689 Rosetta Predictions human pricing
XM_001719885 Rosetta Predictions human pricing
NM_001109184 Rosetta Predictions rat pricing
NM_177203 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001130109 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00386924 predicted 501
2 SASI_Hs02_00386925 predicted 410
3 SASI_Hs02_00386926 predicted 271
4 SASI_Hs02_00386927 predicted 389
5 SASI_Hs02_00386928 predicted 214
6 SASI_Hs02_00386929 predicted 270
7 SASI_Hs02_00386930 predicted 409
8 SASI_Hs02_00386931 predicted 540
9 SASI_Hs02_00386932 predicted 494
10 SASI_Hs02_00386933 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001133689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00391237 predicted 502
2 SASI_Hs02_00391238 predicted 412
3 SASI_Hs02_00391239 predicted 277
4 SASI_Hs02_00391240 predicted 391
5 SASI_Hs02_00391241 predicted 218
6 SASI_Hs02_00391242 predicted 267
7 SASI_Hs02_00391243 predicted 409
8 SASI_Hs02_00391244 predicted 537
9 SASI_Hs02_00391245 predicted 493
10 SASI_Hs02_00391246 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00433196 predicted 504
2 SASI_Hs02_00433197 predicted 409
3 SASI_Hs02_00433198 predicted 280
4 SASI_Hs02_00433199 predicted 362
5 SASI_Hs02_00433200 predicted 393
6 SASI_Hs02_00433201 predicted 215
7 SASI_Hs02_00433202 predicted 263
8 SASI_Hs02_00433203 predicted 405
9 SASI_Hs02_00433204 predicted 545
10 SASI_Hs02_00433205 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109184 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245950 predicted 767
2 SASI_Rn02_00245951 predicted 613
3 SASI_Rn02_00245952 predicted 318
4 SASI_Rn02_00245953 predicted 503
5 SASI_Rn02_00245954 predicted 242
6 SASI_Rn02_00245955 predicted 653
7 SASI_Rn02_00245956 predicted 592
8 SASI_Rn02_00245957 predicted 366
9 SASI_Rn02_00245958 predicted 733
10 SASI_Rn02_00245959 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177203 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153289 predicted 1257
2 SASI_Mm01_00153291 predicted 1375
3 SASI_Mm01_00153292 predicted 1076
4 SASI_Mm01_00153293 predicted 999
5 SASI_Mm01_00153295 predicted 1109
6 SASI_Mm01_00153296 predicted 1046
7 SASI_Mm02_00347220 predicted 1255
8 SASI_Mm01_00153297 predicted 979
9 SASI_Mm02_00347221 predicted 1110
10 SASI_Mm01_00153298 predicted 1142
11 SASI_Mm01_00153290 predicted 1195
12 SASI_Mm01_00153294 predicted 1134
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001144986
CCDC169 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 169
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144986.1-493s21c1
Sequence:CCGGCCGTACATACCTAGCTGAAATCTCGAGATTTCAGCTAGGTATGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144986.1-563s21c1
Sequence:CCGGCAACTGCCTAGGATGCAAGAGCTCGAGCTCTTGCATCCTAGGCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144986.1-527s21c1
Sequence:CCGGGGTTTACATCAAGTTTCTAAACTCGAGTTTAGAAACTTGATGTAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144986.1-466s21c1
Sequence:CCGGGGCTTACCAGAAGATCAACAACTCGAGTTGTTGATCTTCTGGTAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144986.1-414s21c1
Sequence:CCGGCTCTTGAAAGTCAAGTGAAATCTCGAGATTTCACTTGACTTTCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001144986
CCDC169 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 169
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144986.1-493s21c1
Sequence:CCGGCCGTACATACCTAGCTGAAATCTCGAGATTTCAGCTAGGTATGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144986.1-563s21c1
Sequence:CCGGCAACTGCCTAGGATGCAAGAGCTCGAGCTCTTGCATCCTAGGCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144986.1-527s21c1
Sequence:CCGGGGTTTACATCAAGTTTCTAAACTCGAGTTTAGAAACTTGATGTAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144986.1-466s21c1
Sequence:CCGGGGCTTACCAGAAGATCAACAACTCGAGTTGTTGATCTTCTGGTAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144986.1-414s21c1
Sequence:CCGGCTCTTGAAAGTCAAGTGAAATCTCGAGATTTCACTTGACTTTCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001144986
CCDC169 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 169
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144986.1-493s21c1
Sequence:CCGGCCGTACATACCTAGCTGAAATCTCGAGATTTCAGCTAGGTATGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144986.1-563s21c1
Sequence:CCGGCAACTGCCTAGGATGCAAGAGCTCGAGCTCTTGCATCCTAGGCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144986.1-527s21c1
Sequence:CCGGGGTTTACATCAAGTTTCTAAACTCGAGTTTAGAAACTTGATGTAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144986.1-466s21c1
Sequence:CCGGGGCTTACCAGAAGATCAACAACTCGAGTTGTTGATCTTCTGGTAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144986.1-414s21c1
Sequence:CCGGCTCTTGAAAGTCAAGTGAAATCTCGAGATTTCACTTGACTTTCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177203
CCDC169 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 169
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177203.1-1050s21c1
Sequence:CCGGAGTGAAAGAATATGCGTTTAGCTCGAGCTAAACGCATATTCTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177203.1-2427s21c1
Sequence:CCGGGTAGATAATAGAACCATAATGCTCGAGCATTATGGTTCTATTATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177203.1-1258s21c1
Sequence:CCGGGCCAAGAAAGGACCAGTTAAACTCGAGTTTAACTGGTCCTTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177203.1-1116s21c1
Sequence:CCGGCCGTTCCTACATCGCGGAAATCTCGAGATTTCCGCGATGTAGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216465    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177203.1-2427s1c1
Sequence:CCGGGTAGATAATAGAACCATAATGCTCGAGCATTATGGTTCTATTATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177203.1-988s21c1
Sequence:CCGGGTGGAATCTTTAAACGTATTACTCGAGTAATACGTTTAAAGATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177203.1-984s1c1
Sequence:CCGGGCCAGTGGAATCTTTAAACGTCTCGAGACGTTTAAAGATTCCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177203.1-1046s1c1
Sequence:CCGGGCCAAGTGAAAGAATATGCGTCTCGAGACGCATATTCTTTCACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177203.1-1258s1c1
Sequence:CCGGGCCAAGAAAGGACCAGTTAAACTCGAGTTTAACTGGTCCTTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177203
CCDC169 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 169
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177203.1-1050s21c1
Sequence:CCGGAGTGAAAGAATATGCGTTTAGCTCGAGCTAAACGCATATTCTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177203.1-2427s21c1
Sequence:CCGGGTAGATAATAGAACCATAATGCTCGAGCATTATGGTTCTATTATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177203.1-1258s21c1
Sequence:CCGGGCCAAGAAAGGACCAGTTAAACTCGAGTTTAACTGGTCCTTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177203.1-1116s21c1
Sequence:CCGGCCGTTCCTACATCGCGGAAATCTCGAGATTTCCGCGATGTAGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216465    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177203.1-2427s1c1
Sequence:CCGGGTAGATAATAGAACCATAATGCTCGAGCATTATGGTTCTATTATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177203.1-988s21c1
Sequence:CCGGGTGGAATCTTTAAACGTATTACTCGAGTAATACGTTTAAAGATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177203.1-984s1c1
Sequence:CCGGGCCAGTGGAATCTTTAAACGTCTCGAGACGTTTAAAGATTCCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177203.1-1046s1c1
Sequence:CCGGGCCAAGTGAAAGAATATGCGTCTCGAGACGCATATTCTTTCACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177203.1-1258s1c1
Sequence:CCGGGCCAAGAAAGGACCAGTTAAACTCGAGTTTAACTGGTCCTTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177203
CCDC169 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 169
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177203.1-1050s21c1
Sequence:CCGGAGTGAAAGAATATGCGTTTAGCTCGAGCTAAACGCATATTCTTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177203.1-2427s21c1
Sequence:CCGGGTAGATAATAGAACCATAATGCTCGAGCATTATGGTTCTATTATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177203.1-1258s21c1
Sequence:CCGGGCCAAGAAAGGACCAGTTAAACTCGAGTTTAACTGGTCCTTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177203.1-1116s21c1
Sequence:CCGGCCGTTCCTACATCGCGGAAATCTCGAGATTTCCGCGATGTAGGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216465    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177203.1-2427s1c1
Sequence:CCGGGTAGATAATAGAACCATAATGCTCGAGCATTATGGTTCTATTATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177203.1-988s21c1
Sequence:CCGGGTGGAATCTTTAAACGTATTACTCGAGTAATACGTTTAAAGATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177203.1-984s1c1
Sequence:CCGGGCCAGTGGAATCTTTAAACGTCTCGAGACGTTTAAAGATTCCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190750    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177203.1-1046s1c1
Sequence:CCGGGCCAAGTGAAAGAATATGCGTCTCGAGACGCATATTCTTTCACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177203.1-1258s1c1
Sequence:CCGGGCCAAGAAAGGACCAGTTAAACTCGAGTTTAACTGGTCCTTTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks