EMAIL THIS PAGE TO A FRIEND

CCDC170

coiled-coil domain containing 170

78 Gene Product Result for
Synonyms: C6orf97 bA282P11.1
UniProtKB ID: Q8IYT3, Q5VXB7, Q6P9E4, Q96KA9, Q9H5M3
Gene ID:
Human(80129) Summary: The function of this gene and its encoded protein is not known. Several genome-wide association studies have implicated the region around this gene to be involved in breast cancer and bone mineral density, but no link to this specific gene has been found. [provided by RefSeq, May 2010]
Mouse(100504234) coiled-coil domain containing 170
Rat(292266) coiled-coil domain containing 170
sheep(101105760) coiled-coil domain containing 170
domestic guinea pig(100734341) coiled-coil domain containing 170
naked mole-rat(101717123) coiled-coil domain containing 170
Zebrafish(791129) coiled-coil domain containing 170
dog(476248) coiled-coil domain containing 170
cow(787062) coiled-coil domain containing 170
domestic cat(101083267) coiled-coil domain containing 170
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025059 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025059 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025059 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025059 Rosetta Predictions human pricing
XM_001065531 Rosetta Predictions rat pricing
XM_214760 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025059 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016265 predicted 1145
2 SASI_Hs01_00016266 predicted 660
3 SASI_Hs01_00016267 predicted 337
4 SASI_Hs01_00016268 predicted 624
5 SASI_Hs02_00357721 predicted 1719
6 SASI_Hs01_00016269 predicted 2058
7 SASI_Hs01_00016271 predicted 1911
8 SASI_Hs02_00357722 predicted 1764
9 SASI_Hs01_00016274 predicted 1136
10 SASI_Hs02_00357723 predicted 685
11 SASI_Hs01_00016270 predicted 655
12 SASI_Hs01_00016272 predicted 2182
13 SASI_Hs01_00016273 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065531 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314494 predicted 609
2 SASI_Rn02_00314495 predicted 290
3 SASI_Rn02_00314496 predicted 1503
4 SASI_Rn02_00314497 predicted 1780
5 SASI_Rn02_00314498 predicted 655
6 SASI_Rn02_00314499 predicted 734
7 SASI_Rn02_00314500 predicted 1536
8 SASI_Rn02_00314501 predicted 330
9 SASI_Rn02_00314502 predicted 521
10 SASI_Rn02_00314503 predicted 1465
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214760 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375565 predicted 1500
2 SASI_Rn02_00375566 predicted 1422
3 SASI_Rn02_00375567 predicted 1555
4 SASI_Rn02_00375568 predicted 1353
5 SASI_Rn02_00375569 predicted 1787
6 SASI_Rn02_00375570 predicted 1534
7 SASI_Rn02_00375571 predicted 1463
8 SASI_Rn02_00375572 predicted 1236
9 SASI_Rn02_00375573 predicted 968
10 SASI_Rn02_00375574 predicted 968
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025059
CCDC170 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 170
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025059.2-1630s1c1
Sequence:CCGGGCATCTTACCATCAGGAACTTCTCGAGAAGTTCCTGATGGTAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025059.2-174s1c1
Sequence:CCGGGAAGTGAACTTGCAGCAACTTCTCGAGAAGTTGCTGCAAGTTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025059.2-2159s1c1
Sequence:CCGGCAAGGCCATTTACAGCTTCTTCTCGAGAAGAAGCTGTAAATGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025059.2-3172s1c1
Sequence:CCGGCCTGTAAGAAACTTGCCTGTTCTCGAGAACAGGCAAGTTTCTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025059.2-2501s1c1
Sequence:CCGGGCCGATTTAGTTCTCACAATACTCGAGTATTGTGAGAACTAAATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025059.2-2087s1c1
Sequence:CCGGCATTCACATCAGCATCACTTTCTCGAGAAAGTGATGCTGATGTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025059.2-1439s1c1
Sequence:CCGGCTGGTTCGTCTTGAGAGCAATCTCGAGATTGCTCTCAAGACGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127646    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025059.2-4650s1c1
Sequence:CCGGCCCTGAATCATGCACCCATAACTCGAGTTATGGGTGCATGATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128192    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025059.2-3206s1c1
Sequence:CCGGCCAGATTATATCTGGTGGTAACTCGAGTTACCACCAGATATAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025059.2-92s1c1
Sequence:CCGGGAGGAAACTTACGATCATCTTCTCGAGAAGATGATCGTAAGTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025059.2-136s1c1
Sequence:CCGGGCAGTTAAACCACTATCGGAACTCGAGTTCCGATAGTGGTTTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025059.2-277s1c1
Sequence:CCGGGAAAGCTGAAATGGAGAGCTACTCGAGTAGCTCTCCATTTCAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025059
CCDC170 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 170
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025059.2-1630s1c1
Sequence:CCGGGCATCTTACCATCAGGAACTTCTCGAGAAGTTCCTGATGGTAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025059.2-174s1c1
Sequence:CCGGGAAGTGAACTTGCAGCAACTTCTCGAGAAGTTGCTGCAAGTTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025059.2-2159s1c1
Sequence:CCGGCAAGGCCATTTACAGCTTCTTCTCGAGAAGAAGCTGTAAATGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025059.2-3172s1c1
Sequence:CCGGCCTGTAAGAAACTTGCCTGTTCTCGAGAACAGGCAAGTTTCTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025059.2-2501s1c1
Sequence:CCGGGCCGATTTAGTTCTCACAATACTCGAGTATTGTGAGAACTAAATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025059.2-2087s1c1
Sequence:CCGGCATTCACATCAGCATCACTTTCTCGAGAAAGTGATGCTGATGTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025059.2-1439s1c1
Sequence:CCGGCTGGTTCGTCTTGAGAGCAATCTCGAGATTGCTCTCAAGACGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127646    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025059.2-4650s1c1
Sequence:CCGGCCCTGAATCATGCACCCATAACTCGAGTTATGGGTGCATGATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128192    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025059.2-3206s1c1
Sequence:CCGGCCAGATTATATCTGGTGGTAACTCGAGTTACCACCAGATATAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025059.2-92s1c1
Sequence:CCGGGAGGAAACTTACGATCATCTTCTCGAGAAGATGATCGTAAGTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025059.2-136s1c1
Sequence:CCGGGCAGTTAAACCACTATCGGAACTCGAGTTCCGATAGTGGTTTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025059.2-277s1c1
Sequence:CCGGGAAAGCTGAAATGGAGAGCTACTCGAGTAGCTCTCCATTTCAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025059
CCDC170 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 170
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025059.2-1630s1c1
Sequence:CCGGGCATCTTACCATCAGGAACTTCTCGAGAAGTTCCTGATGGTAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025059.2-174s1c1
Sequence:CCGGGAAGTGAACTTGCAGCAACTTCTCGAGAAGTTGCTGCAAGTTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025059.2-2159s1c1
Sequence:CCGGCAAGGCCATTTACAGCTTCTTCTCGAGAAGAAGCTGTAAATGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025059.2-3172s1c1
Sequence:CCGGCCTGTAAGAAACTTGCCTGTTCTCGAGAACAGGCAAGTTTCTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025059.2-2501s1c1
Sequence:CCGGGCCGATTTAGTTCTCACAATACTCGAGTATTGTGAGAACTAAATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025059.2-2087s1c1
Sequence:CCGGCATTCACATCAGCATCACTTTCTCGAGAAAGTGATGCTGATGTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025059.2-1439s1c1
Sequence:CCGGCTGGTTCGTCTTGAGAGCAATCTCGAGATTGCTCTCAAGACGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127646    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025059.2-4650s1c1
Sequence:CCGGCCCTGAATCATGCACCCATAACTCGAGTTATGGGTGCATGATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128192    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025059.2-3206s1c1
Sequence:CCGGCCAGATTATATCTGGTGGTAACTCGAGTTACCACCAGATATAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025059.2-92s1c1
Sequence:CCGGGAGGAAACTTACGATCATCTTCTCGAGAAGATGATCGTAAGTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025059.2-136s1c1
Sequence:CCGGGCAGTTAAACCACTATCGGAACTCGAGTTCCGATAGTGGTTTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128984    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025059.2-277s1c1
Sequence:CCGGGAAAGCTGAAATGGAGAGCTACTCGAGTAGCTCTCCATTTCAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks