EMAIL THIS PAGE TO A FRIEND

CCDC171

coiled-coil domain containing 171

88 Gene Product Result for
Synonyms: C9orf93 bA536D16.1 bA778P13.1
Gene ID:
Mouse(320226) coiled-coil domain containing 171
dog(474713) coiled-coil domain containing 171
cow(538331) coiled-coil domain containing 171
domestic cat(101081008) coiled-coil domain containing 171
naked mole-rat(101717709) coiled-coil domain containing 171
domestic guinea pig(100714957) coiled-coil domain containing 171
sheep(101122165) coiled-coil domain containing 171
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173550 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173550 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173550 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081012 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081012 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081012 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173550 Rosetta Predictions human pricing
NM_001081012 Rosetta Predictions mouse pricing
XM_001001270 Rosetta Predictions mouse pricing
XM_001001288 Rosetta Predictions mouse pricing
XM_001001298 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173550 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368358 predicted 3495
2 SASI_Hs01_00221218 predicted 3978
3 SASI_Hs01_00221219 predicted 793
4 SASI_Hs01_00221221 predicted 2413
5 SASI_Hs02_00368359 predicted 472
6 SASI_Hs01_00221222 predicted 1759
7 SASI_Hs01_00221223 predicted 327
8 SASI_Hs01_00221224 predicted 1579
9 SASI_Hs01_00221227 predicted 1647
10 SASI_Hs02_00368360 predicted 3468
11 SASI_Hs01_00221220 predicted 1216
12 SASI_Hs01_00221225 predicted 917
13 SASI_Hs01_00221226 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081012 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294366 predicted 1776
2 SASI_Mm02_00294367 predicted 1168
3 SASI_Mm02_00294368 predicted 418
4 SASI_Mm02_00294369 predicted 1229
5 SASI_Mm02_00294370 predicted 980
6 SASI_Mm02_00294371 predicted 1392
7 SASI_Mm02_00294372 predicted 2563
8 SASI_Mm02_00294373 predicted 4174
9 SASI_Mm02_00294374 predicted 2192
10 SASI_Mm02_00294375 predicted 1323
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001270 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280158 predicted 707
2 SASI_Mm01_00280159 predicted 423
3 SASI_Mm01_00280160 predicted 793
4 SASI_Mm01_00280161 predicted 707
5 SASI_Mm01_00280162 predicted 469
6 SASI_Mm01_00280163 predicted 716
7 SASI_Mm01_00280164 predicted 730
8 SASI_Mm01_00280165 predicted 830
9 SASI_Mm01_00280166 predicted 894
10 SASI_Mm01_00280167 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001288 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246733 predicted 4290
2 SASI_Mm01_00246734 predicted 4187
3 SASI_Mm01_00246735 predicted 3757
4 SASI_Mm01_00246736 predicted 3761
5 SASI_Mm01_00246737 predicted 4004
6 SASI_Mm01_00246738 predicted 3752
7 SASI_Mm01_00246739 predicted 4177
8 SASI_Mm01_00246740 predicted 4192
9 SASI_Mm01_00246741 predicted 3794
10 SASI_Mm01_00246742 predicted 4020
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001298 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00243053 predicted 1127
2 SASI_Mm01_00243054 predicted 1026
3 SASI_Mm01_00243055 predicted 592
4 SASI_Mm01_00243056 predicted 606
5 SASI_Mm01_00243057 predicted 834
6 SASI_Mm01_00243058 predicted 594
7 SASI_Mm01_00243059 predicted 1021
8 SASI_Mm01_00243060 predicted 1023
9 SASI_Mm01_00243061 predicted 623
10 SASI_Mm01_00243062 predicted 863
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173550
CCDC171 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 171
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173550.2-1867s1c1
Sequence:CCGGGCAGACCGAGAGGCTTTAATACTCGAGTATTAAAGCCTCTCGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173550.2-3145s1c1
Sequence:CCGGGCCCATGGACTTCATAAAGTACTCGAGTACTTTATGAAGTCCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173550.2-1874s1c1
Sequence:CCGGGAGAGGCTTTAATAAGCACTTCTCGAGAAGTGCTTATTAAAGCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173550.2-3231s1c1
Sequence:CCGGGCAGAAGCAAATACTTGGATTCTCGAGAATCCAAGTATTTGCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173550.2-363s1c1
Sequence:CCGGGATTGCCTCATTGGATGTAAACTCGAGTTTACATCCAATGAGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173550.2-3632s1c1
Sequence:CCGGGTCAGCTCAATAGACATCTTACTCGAGTAAGATGTCTATTGAGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173550.2-2719s1c1
Sequence:CCGGCGGAAAGGTGTTATTGCTGTTCTCGAGAACAGCAATAACACCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173550.2-1467s1c1
Sequence:CCGGCCTTTCAAAGAGACTCCAGTACTCGAGTACTGGAGTCTCTTTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173550.2-1072s1c1
Sequence:CCGGCGGCGACAAACAAGTGAACTTCTCGAGAAGTTCACTTGTTTGTCGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173550.2-4009s1c1
Sequence:CCGGGCAGCCTTGAAATCAGAACTTCTCGAGAAGTTCTGATTTCAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173550.2-3745s1c1
Sequence:CCGGGCTAATCACATGAGAGCAGTACTCGAGTACTGCTCTCATGTGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173550
CCDC171 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 171
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173550.2-1867s1c1
Sequence:CCGGGCAGACCGAGAGGCTTTAATACTCGAGTATTAAAGCCTCTCGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173550.2-3145s1c1
Sequence:CCGGGCCCATGGACTTCATAAAGTACTCGAGTACTTTATGAAGTCCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173550.2-1874s1c1
Sequence:CCGGGAGAGGCTTTAATAAGCACTTCTCGAGAAGTGCTTATTAAAGCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173550.2-3231s1c1
Sequence:CCGGGCAGAAGCAAATACTTGGATTCTCGAGAATCCAAGTATTTGCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173550.2-363s1c1
Sequence:CCGGGATTGCCTCATTGGATGTAAACTCGAGTTTACATCCAATGAGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173550.2-3632s1c1
Sequence:CCGGGTCAGCTCAATAGACATCTTACTCGAGTAAGATGTCTATTGAGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173550.2-2719s1c1
Sequence:CCGGCGGAAAGGTGTTATTGCTGTTCTCGAGAACAGCAATAACACCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173550.2-1467s1c1
Sequence:CCGGCCTTTCAAAGAGACTCCAGTACTCGAGTACTGGAGTCTCTTTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173550.2-1072s1c1
Sequence:CCGGCGGCGACAAACAAGTGAACTTCTCGAGAAGTTCACTTGTTTGTCGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173550.2-4009s1c1
Sequence:CCGGGCAGCCTTGAAATCAGAACTTCTCGAGAAGTTCTGATTTCAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173550.2-3745s1c1
Sequence:CCGGGCTAATCACATGAGAGCAGTACTCGAGTACTGCTCTCATGTGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173550
CCDC171 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 171
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173550.2-1867s1c1
Sequence:CCGGGCAGACCGAGAGGCTTTAATACTCGAGTATTAAAGCCTCTCGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173550.2-3145s1c1
Sequence:CCGGGCCCATGGACTTCATAAAGTACTCGAGTACTTTATGAAGTCCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173550.2-1874s1c1
Sequence:CCGGGAGAGGCTTTAATAAGCACTTCTCGAGAAGTGCTTATTAAAGCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173550.2-3231s1c1
Sequence:CCGGGCAGAAGCAAATACTTGGATTCTCGAGAATCCAAGTATTTGCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173550.2-363s1c1
Sequence:CCGGGATTGCCTCATTGGATGTAAACTCGAGTTTACATCCAATGAGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173550.2-3632s1c1
Sequence:CCGGGTCAGCTCAATAGACATCTTACTCGAGTAAGATGTCTATTGAGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173550.2-2719s1c1
Sequence:CCGGCGGAAAGGTGTTATTGCTGTTCTCGAGAACAGCAATAACACCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173550.2-1467s1c1
Sequence:CCGGCCTTTCAAAGAGACTCCAGTACTCGAGTACTGGAGTCTCTTTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173550.2-1072s1c1
Sequence:CCGGCGGCGACAAACAAGTGAACTTCTCGAGAAGTTCACTTGTTTGTCGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173550.2-4009s1c1
Sequence:CCGGGCAGCCTTGAAATCAGAACTTCTCGAGAAGTTCTGATTTCAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173550.2-3745s1c1
Sequence:CCGGGCTAATCACATGAGAGCAGTACTCGAGTACTGCTCTCATGTGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081012
CCDC171 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 171
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000266972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081012.1-1571s21c1
Sequence:CCGGTAGTGGAGACATGCGAGAATACTCGAGTATTCTCGCATGTCTCCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081012.1-932s21c1
Sequence:CCGGAGACCGCATTGGGCGAATTTACTCGAGTAAATTCGCCCAATGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081012.1-2194s21c1
Sequence:CCGGATAAGCCATCTGGAGTATATCCTCGAGGATATACTCCAGATGGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081012.1-4328s21c1
Sequence:CCGGAGGAAGAGCCAGTGGTATAATCTCGAGATTATACCACTGGCTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081012.1-4280s21c1
Sequence:CCGGGACCGTCTCAGATAGGATTATCTCGAGATAATCCTATCTGAGACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081012
CCDC171 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 171
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000266972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081012.1-1571s21c1
Sequence:CCGGTAGTGGAGACATGCGAGAATACTCGAGTATTCTCGCATGTCTCCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081012.1-932s21c1
Sequence:CCGGAGACCGCATTGGGCGAATTTACTCGAGTAAATTCGCCCAATGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081012.1-2194s21c1
Sequence:CCGGATAAGCCATCTGGAGTATATCCTCGAGGATATACTCCAGATGGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081012.1-4328s21c1
Sequence:CCGGAGGAAGAGCCAGTGGTATAATCTCGAGATTATACCACTGGCTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081012.1-4280s21c1
Sequence:CCGGGACCGTCTCAGATAGGATTATCTCGAGATAATCCTATCTGAGACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081012
CCDC171 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 171
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000266972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081012.1-1571s21c1
Sequence:CCGGTAGTGGAGACATGCGAGAATACTCGAGTATTCTCGCATGTCTCCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081012.1-932s21c1
Sequence:CCGGAGACCGCATTGGGCGAATTTACTCGAGTAAATTCGCCCAATGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081012.1-2194s21c1
Sequence:CCGGATAAGCCATCTGGAGTATATCCTCGAGGATATACTCCAGATGGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081012.1-4328s21c1
Sequence:CCGGAGGAAGAGCCAGTGGTATAATCTCGAGATTATACCACTGGCTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081012.1-4280s21c1
Sequence:CCGGGACCGTCTCAGATAGGATTATCTCGAGATAATCCTATCTGAGACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks