EMAIL THIS PAGE TO A FRIEND

CCDC172

coiled-coil domain containing 172

64 Gene Product Result for
Synonyms: C10orf96
UniProtKB ID: P0C7W6
Gene ID:
Mouse(75645) coiled-coil domain containing 172
Rat(361776) coiled-coil domain containing 172
sheep(101103108) coiled-coil domain containing 172
domestic guinea pig(100722504) coiled-coil domain containing 172
naked mole-rat(101699514) coiled-coil domain containing 172
Zebrafish(793687) coiled-coil domain containing 172
cow(522573) coiled-coil domain containing 172
domestic cat(101082950) coiled-coil domain containing 172
dog(610491) coiled-coil domain containing 172
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198515 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198515 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198515 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029372 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029372 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029372 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198515 Rosetta Predictions human pricing
NM_001014169 Rosetta Predictions rat pricing
NM_029372 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061801 predicted 1066
2 SASI_Hs02_00372094 predicted 523
3 SASI_Hs01_00061803 predicted 883
4 SASI_Hs01_00061805 predicted 1006
5 SASI_Hs01_00061806 predicted 482
6 SASI_Hs01_00061807 predicted 516
7 SASI_Hs01_00061808 predicted 978
8 SASI_Hs01_00061809 predicted 595
9 SASI_Hs01_00061810 predicted 536
10 SASI_Hs02_00372095 predicted 697
11 SASI_Hs01_00061802 predicted 1053
12 SASI_Hs01_00061804 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014169 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057622 predicted 886
2 SASI_Rn01_00057623 predicted 926
3 SASI_Rn01_00057624 predicted 433
4 SASI_Rn01_00057625 predicted 572
5 SASI_Rn01_00057626 predicted 629
6 SASI_Rn02_00201662 predicted 428
7 SASI_Rn01_00057627 predicted 404
8 SASI_Rn02_00201663 predicted 408
9 SASI_Rn01_00057628 predicted 908
10 SASI_Rn02_00201664 predicted 570
11 SASI_Rn01_00057629 predicted 324
12 SASI_Rn01_00057630 predicted 1119
13 SASI_Rn01_00057631 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029372 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335245 predicted 768
2 SASI_Mm01_00137860 predicted 328
3 SASI_Mm02_00335246 predicted 771
4 SASI_Mm01_00137863 predicted 680
5 SASI_Mm01_00137866 predicted 716
6 SASI_Mm01_00137867 predicted 299
7 SASI_Mm02_00335247 predicted 649
8 SASI_Mm01_00137868 predicted 281
9 SASI_Mm02_00335248 predicted 448
10 SASI_Mm02_00335249 predicted 423
11 SASI_Mm01_00137859 predicted 667
12 SASI_Mm01_00137861 predicted 558
13 SASI_Mm01_00137862 predicted 754
14 SASI_Mm01_00137864 predicted 358
15 SASI_Mm01_00137865 predicted 329
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198515
CCDC172 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 172
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-324s1c1
Sequence:CCGGCGAGAAGTAAGGTCGGAAATACTCGAGTATTTCCGACCTTACTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-378s1c1
Sequence:CCGGGAGGAGCTGAATGAAGAGAAACTCGAGTTTCTCTTCATTCAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-278s1c1
Sequence:CCGGCATCATCTTCACCGAGCATCACTCGAGTGATGCTCGGTGAAGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198515.1-323s1c1
Sequence:CCGGGCGAGAAGTAAGGTCGGAAATCTCGAGATTTCCGACCTTACTTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198515.1-313s1c1
Sequence:CCGGGCCGTTTGATGCGAGAAGTAACTCGAGTTACTTCTCGCATCAAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-987s1c1
Sequence:CCGGGAGTTGACATTGGCACAGAAACTCGAGTTTCTGTGCCAATGTCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198515.1-404s1c1
Sequence:CCGGGCTGGAATCTAAGGTTCAACACTCGAGTGTTGAACCTTAGATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-506s1c1
Sequence:CCGGCCATAGGAATATGCTTCTTCACTCGAGTGAAGAAGCATATTCCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198515.1-838s1c1
Sequence:CCGGCCAAATATCTAGAGGCAGAAACTCGAGTTTCTGCCTCTAGATATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198515.1-522s1c1
Sequence:CCGGCTTCAAACCTTTGAGGCTATACTCGAGTATAGCCTCAAAGGTTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-339s1c1
Sequence:CCGGGAAATAACCAGATGTCGTGAACTCGAGTTCACGACATCTGGTTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-933s1c1
Sequence:CCGGGAAGATGACATGGAAAGTGTTCTCGAGAACACTTTCCATGTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-1000s1c1
Sequence:CCGGCACAGAAAGATCTTCAGGAAACTCGAGTTTCCTGAAGATCTTTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-545s1c1
Sequence:CCGGGAAACAAATGATAGAGGAGGACTCGAGTCCTCCTCTATCATTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-1004s1c1
Sequence:CCGGGAAAGATCTTCAGGAAAGCAACTCGAGTTGCTTTCCTGAAGATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198515
CCDC172 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 172
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-324s1c1
Sequence:CCGGCGAGAAGTAAGGTCGGAAATACTCGAGTATTTCCGACCTTACTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-378s1c1
Sequence:CCGGGAGGAGCTGAATGAAGAGAAACTCGAGTTTCTCTTCATTCAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-278s1c1
Sequence:CCGGCATCATCTTCACCGAGCATCACTCGAGTGATGCTCGGTGAAGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198515.1-323s1c1
Sequence:CCGGGCGAGAAGTAAGGTCGGAAATCTCGAGATTTCCGACCTTACTTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198515.1-313s1c1
Sequence:CCGGGCCGTTTGATGCGAGAAGTAACTCGAGTTACTTCTCGCATCAAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-987s1c1
Sequence:CCGGGAGTTGACATTGGCACAGAAACTCGAGTTTCTGTGCCAATGTCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198515.1-404s1c1
Sequence:CCGGGCTGGAATCTAAGGTTCAACACTCGAGTGTTGAACCTTAGATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-506s1c1
Sequence:CCGGCCATAGGAATATGCTTCTTCACTCGAGTGAAGAAGCATATTCCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198515.1-838s1c1
Sequence:CCGGCCAAATATCTAGAGGCAGAAACTCGAGTTTCTGCCTCTAGATATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198515.1-522s1c1
Sequence:CCGGCTTCAAACCTTTGAGGCTATACTCGAGTATAGCCTCAAAGGTTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-339s1c1
Sequence:CCGGGAAATAACCAGATGTCGTGAACTCGAGTTCACGACATCTGGTTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-933s1c1
Sequence:CCGGGAAGATGACATGGAAAGTGTTCTCGAGAACACTTTCCATGTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-1000s1c1
Sequence:CCGGCACAGAAAGATCTTCAGGAAACTCGAGTTTCCTGAAGATCTTTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-545s1c1
Sequence:CCGGGAAACAAATGATAGAGGAGGACTCGAGTCCTCCTCTATCATTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-1004s1c1
Sequence:CCGGGAAAGATCTTCAGGAAAGCAACTCGAGTTGCTTTCCTGAAGATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198515
CCDC172 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 172
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-324s1c1
Sequence:CCGGCGAGAAGTAAGGTCGGAAATACTCGAGTATTTCCGACCTTACTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-378s1c1
Sequence:CCGGGAGGAGCTGAATGAAGAGAAACTCGAGTTTCTCTTCATTCAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-278s1c1
Sequence:CCGGCATCATCTTCACCGAGCATCACTCGAGTGATGCTCGGTGAAGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198515.1-323s1c1
Sequence:CCGGGCGAGAAGTAAGGTCGGAAATCTCGAGATTTCCGACCTTACTTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198515.1-313s1c1
Sequence:CCGGGCCGTTTGATGCGAGAAGTAACTCGAGTTACTTCTCGCATCAAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-987s1c1
Sequence:CCGGGAGTTGACATTGGCACAGAAACTCGAGTTTCTGTGCCAATGTCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198515.1-404s1c1
Sequence:CCGGGCTGGAATCTAAGGTTCAACACTCGAGTGTTGAACCTTAGATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-506s1c1
Sequence:CCGGCCATAGGAATATGCTTCTTCACTCGAGTGAAGAAGCATATTCCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198515.1-838s1c1
Sequence:CCGGCCAAATATCTAGAGGCAGAAACTCGAGTTTCTGCCTCTAGATATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198515.1-522s1c1
Sequence:CCGGCTTCAAACCTTTGAGGCTATACTCGAGTATAGCCTCAAAGGTTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-339s1c1
Sequence:CCGGGAAATAACCAGATGTCGTGAACTCGAGTTCACGACATCTGGTTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-933s1c1
Sequence:CCGGGAAGATGACATGGAAAGTGTTCTCGAGAACACTTTCCATGTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-1000s1c1
Sequence:CCGGCACAGAAAGATCTTCAGGAAACTCGAGTTTCCTGAAGATCTTTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-545s1c1
Sequence:CCGGGAAACAAATGATAGAGGAGGACTCGAGTCCTCCTCTATCATTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198515.1-1004s1c1
Sequence:CCGGGAAAGATCTTCAGGAAAGCAACTCGAGTTGCTTTCCTGAAGATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029372
CCDC172 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 172
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029372.1-181s1c1
Sequence:CCGGGATTACCAGATGTCGTGGGAACTCGAGTTCCCACGACATCTGGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029372.1-490s1c1
Sequence:CCGGCGAGATGGAAATGGCTGACTTCTCGAGAAGTCAGCCATTTCCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029372.1-929s1c1
Sequence:CCGGGAGCTGATCTCTACGTGAACACTCGAGTGTTCACGTAGAGATCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029372.1-328s1c1
Sequence:CCGGGCTCAGTGAGATTATCAGCGACTCGAGTCGCTGATAATCTCACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029372.1-322s1c1
Sequence:CCGGGAGACAGCTCAGTGAGATTATCTCGAGATAATCTCACTGAGCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029372
CCDC172 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 172
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029372.1-181s1c1
Sequence:CCGGGATTACCAGATGTCGTGGGAACTCGAGTTCCCACGACATCTGGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029372.1-490s1c1
Sequence:CCGGCGAGATGGAAATGGCTGACTTCTCGAGAAGTCAGCCATTTCCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029372.1-929s1c1
Sequence:CCGGGAGCTGATCTCTACGTGAACACTCGAGTGTTCACGTAGAGATCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029372.1-328s1c1
Sequence:CCGGGCTCAGTGAGATTATCAGCGACTCGAGTCGCTGATAATCTCACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029372.1-322s1c1
Sequence:CCGGGAGACAGCTCAGTGAGATTATCTCGAGATAATCTCACTGAGCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029372
CCDC172 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 172
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029372.1-181s1c1
Sequence:CCGGGATTACCAGATGTCGTGGGAACTCGAGTTCCCACGACATCTGGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029372.1-490s1c1
Sequence:CCGGCGAGATGGAAATGGCTGACTTCTCGAGAAGTCAGCCATTTCCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029372.1-929s1c1
Sequence:CCGGGAGCTGATCTCTACGTGAACACTCGAGTGTTCACGTAGAGATCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029372.1-328s1c1
Sequence:CCGGGCTCAGTGAGATTATCAGCGACTCGAGTCGCTGATAATCTCACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029372.1-322s1c1
Sequence:CCGGGAGACAGCTCAGTGAGATTATCTCGAGATAATCTCACTGAGCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks