EMAIL THIS PAGE TO A FRIEND

CCDC173

coiled-coil domain containing 173

63 Gene Product Result for
Synonyms: C2orf77
UniProtKB ID: Q0VFZ6, Q6PJF6
Gene ID:
Mouse(75051) coiled-coil domain containing 173
Rat(311113) coiled-coil domain containing 173
Zebrafish(559457) coiled-coil domain containing 173
domestic cat(101088351) coiled-coil domain containing 173
cow(616485) coiled-coil domain containing 173
dog(478786) coiled-coil domain containing 173
naked mole-rat(101721648) coiled-coil domain containing 173
domestic guinea pig(100733075) coiled-coil domain containing 173
sheep(101119534) coiled-coil domain containing 173
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001077684 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001077684 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001077684 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001085447 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001085447 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001085447 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033511 MISSION® esiRNA esiRNA human C2orf77 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085447 Rosetta Predictions human pricing
XM_926895 Rosetta Predictions human pricing
NM_001127486 Rosetta Predictions rat pricing
NM_001077684 Rosetta Predictions mouse pricing
XM_130326 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317735 predicted 296
2 SASI_Hs02_00317736 predicted 1513
3 SASI_Hs02_00317737 predicted 1642
4 SASI_Hs02_00317738 predicted 1492
5 SASI_Hs02_00317739 predicted 1510
6 SASI_Hs02_00317740 predicted 338
7 SASI_Hs02_00317741 predicted 330
8 SASI_Hs02_00317742 predicted 378
9 SASI_Hs02_00317743 predicted 276
10 SASI_Hs02_00317744 predicted 1650
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00294979 predicted 608
2 SASI_Hs01_00294980 predicted 606
3 SASI_Hs01_00294981 predicted 452
4 SASI_Hs01_00294982 predicted 597
5 SASI_Hs01_00294983 predicted 464
6 SASI_Hs01_00294984 predicted 602
7 SASI_Hs01_00294985 predicted 562
8 SASI_Hs01_00294986 predicted 609
9 SASI_Hs01_00294987 predicted 610
10 SASI_Hs01_00294988 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127486 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253863 predicted 1414
2 SASI_Rn02_00253864 predicted 381
3 SASI_Rn02_00253865 predicted 1451
4 SASI_Rn02_00253866 predicted 216
5 SASI_Rn02_00253867 predicted 241
6 SASI_Rn02_00253868 predicted 247
7 SASI_Rn02_00253869 predicted 344
8 SASI_Rn02_00253870 predicted 1407
9 SASI_Rn02_00253871 predicted 1516
10 SASI_Rn02_00253872 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077684 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292852 predicted 1431
2 SASI_Mm02_00292853 predicted 1315
3 SASI_Mm02_00292854 predicted 1420
4 SASI_Mm02_00292855 predicted 204
5 SASI_Mm02_00292856 predicted 281
6 SASI_Mm02_00292857 predicted 288
7 SASI_Mm02_00292858 predicted 279
8 SASI_Mm02_00292859 predicted 366
9 SASI_Mm02_00292860 predicted 1374
10 SASI_Mm02_00292861 predicted 1403
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130326 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221408 predicted 1504
2 SASI_Mm01_00221409 predicted 1520
3 SASI_Mm01_00221410 predicted 1409
4 SASI_Mm01_00221411 predicted 1511
5 SASI_Mm01_00221412 predicted 375
6 SASI_Mm01_00221413 predicted 1415
7 SASI_Mm01_00221414 predicted 208
8 SASI_Mm01_00221415 predicted 379
9 SASI_Mm01_00221416 predicted 1495
10 SASI_Mm01_00221417 predicted 374
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001077684
CCDC173 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 173
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077684.1-1311s21c1
Sequence:CCGGATTCAGCAAATAGCCATAAATCTCGAGATTTATGGCTATTTGCTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077684.1-1469s21c1
Sequence:CCGGATACGCCTACCCTATGGTAAACTCGAGTTTACCATAGGGTAGGCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077684.1-950s21c1
Sequence:CCGGTGCTGAAACACATAGGCTAATCTCGAGATTAGCCTATGTGTTTCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077684.1-134s21c1
Sequence:CCGGTCTCCAGCAGATCACCATAATCTCGAGATTATGGTGATCTGCTGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077684.1-1423s21c1
Sequence:CCGGAGTATGCTAGAGAAGTAATTACTCGAGTAATTACTTCTCTAGCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001077684
CCDC173 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 173
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077684.1-1311s21c1
Sequence:CCGGATTCAGCAAATAGCCATAAATCTCGAGATTTATGGCTATTTGCTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077684.1-1469s21c1
Sequence:CCGGATACGCCTACCCTATGGTAAACTCGAGTTTACCATAGGGTAGGCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077684.1-950s21c1
Sequence:CCGGTGCTGAAACACATAGGCTAATCTCGAGATTAGCCTATGTGTTTCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077684.1-134s21c1
Sequence:CCGGTCTCCAGCAGATCACCATAATCTCGAGATTATGGTGATCTGCTGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077684.1-1423s21c1
Sequence:CCGGAGTATGCTAGAGAAGTAATTACTCGAGTAATTACTTCTCTAGCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001077684
CCDC173 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 173
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077684.1-1311s21c1
Sequence:CCGGATTCAGCAAATAGCCATAAATCTCGAGATTTATGGCTATTTGCTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077684.1-1469s21c1
Sequence:CCGGATACGCCTACCCTATGGTAAACTCGAGTTTACCATAGGGTAGGCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077684.1-950s21c1
Sequence:CCGGTGCTGAAACACATAGGCTAATCTCGAGATTAGCCTATGTGTTTCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077684.1-134s21c1
Sequence:CCGGTCTCCAGCAGATCACCATAATCTCGAGATTATGGTGATCTGCTGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077684.1-1423s21c1
Sequence:CCGGAGTATGCTAGAGAAGTAATTACTCGAGTAATTACTTCTCTAGCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085447
CCDC173 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 173
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085447.1-1511s21c1
Sequence:CCGGGACTATGCCAGAGAGGTAATTCTCGAGAATTACCTCTCTGGCATAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085447.1-1780s21c1
Sequence:CCGGGACTAAGTTGTAGCATATATGCTCGAGCATATATGCTACAACTTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085447.1-1444s21c1
Sequence:CCGGACAAGCAGAATTAGATTATTGCTCGAGCAATAATCTAATTCTGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085447.1-1383s21c1
Sequence:CCGGAGGTTCAAGATGCCCATATTCCTCGAGGAATATGGGCATCTTGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085447.1-1621s21c1
Sequence:CCGGTGTGGACAGAGGTGGATTAAGCTCGAGCTTAATCCACCTCTGTCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085447
CCDC173 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 173
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085447.1-1511s21c1
Sequence:CCGGGACTATGCCAGAGAGGTAATTCTCGAGAATTACCTCTCTGGCATAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085447.1-1780s21c1
Sequence:CCGGGACTAAGTTGTAGCATATATGCTCGAGCATATATGCTACAACTTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085447.1-1444s21c1
Sequence:CCGGACAAGCAGAATTAGATTATTGCTCGAGCAATAATCTAATTCTGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085447.1-1383s21c1
Sequence:CCGGAGGTTCAAGATGCCCATATTCCTCGAGGAATATGGGCATCTTGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085447.1-1621s21c1
Sequence:CCGGTGTGGACAGAGGTGGATTAAGCTCGAGCTTAATCCACCTCTGTCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085447
CCDC173 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 173
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085447.1-1511s21c1
Sequence:CCGGGACTATGCCAGAGAGGTAATTCTCGAGAATTACCTCTCTGGCATAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264077    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085447.1-1780s21c1
Sequence:CCGGGACTAAGTTGTAGCATATATGCTCGAGCATATATGCTACAACTTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085447.1-1444s21c1
Sequence:CCGGACAAGCAGAATTAGATTATTGCTCGAGCAATAATCTAATTCTGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085447.1-1383s21c1
Sequence:CCGGAGGTTCAAGATGCCCATATTCCTCGAGGAATATGGGCATCTTGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085447.1-1621s21c1
Sequence:CCGGTGTGGACAGAGGTGGATTAAGCTCGAGCTTAATCCACCTCTGTCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)