EMAIL THIS PAGE TO A FRIEND

CCDC174

coiled-coil domain containing 174

57 Gene Product Result for
Synonyms: C3orf19
UniProtKB ID: Q6PII3, Q96CS5
Gene ID:
Mouse(232236) coiled-coil domain containing 174
Rat(297458) coiled-coil domain containing 174
sheep(101104788) coiled-coil domain containing 174
domestic guinea pig(100722503) coiled-coil domain containing 174
naked mole-rat(101703256) coiled-coil domain containing 174
Zebrafish(541361) coiled-coil domain containing 174
cow(512697) coiled-coil domain containing 174
domestic cat(101101120) coiled-coil domain containing 174
dog(100686384) coiled-coil domain containing 174
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016474 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016474 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016474 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172730 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172730 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172730 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092921 MISSION® esiRNA esiRNA human C3orf19 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016474 Rosetta Predictions human pricing
NM_001009659 Rosetta Predictions rat pricing
NM_172730 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128649 predicted 560
2 SASI_Hs02_00349518 predicted 378
3 SASI_Hs02_00349519 predicted 240
4 SASI_Hs02_00349520 predicted 437
5 SASI_Hs02_00349521 predicted 383
6 SASI_Hs02_00349522 predicted 299
7 SASI_Hs02_00349523 predicted 248
8 SASI_Hs01_00128654 predicted 406
9 SASI_Hs01_00128656 predicted 1482
10 SASI_Hs01_00128657 predicted 1577
11 SASI_Hs01_00128648 predicted 1755
12 SASI_Hs01_00128650 predicted 1701
13 SASI_Hs01_00128651 predicted 1749
14 SASI_Hs01_00128652 predicted 1626
15 SASI_Hs01_00128653 predicted 1490
16 SASI_Hs01_00128655 predicted 1684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009659 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096252 predicted 637
2 SASI_Rn01_00096253 predicted 911
3 SASI_Rn01_00096255 predicted 726
4 SASI_Rn01_00096256 predicted 823
5 SASI_Rn01_00096257 predicted 1276
6 SASI_Rn01_00096258 predicted 678
7 SASI_Rn01_00096259 predicted 889
8 SASI_Rn01_00096260 predicted 387
9 SASI_Rn01_00096261 predicted 461
10 SASI_Rn02_00199688 predicted 914
11 SASI_Rn01_00096254 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172730 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200360 predicted 672
2 SASI_Mm02_00344536 predicted 282
3 SASI_Mm01_00200362 predicted 1468
4 SASI_Mm01_00200364 predicted 890
5 SASI_Mm01_00200366 predicted 1507
6 SASI_Mm01_00200367 predicted 1486
7 SASI_Mm02_00344537 predicted 1414
8 SASI_Mm01_00200369 predicted 819
9 SASI_Mm02_00344538 predicted 910
10 SASI_Mm02_00344539 predicted 627
11 SASI_Mm01_00200361 predicted 3542
12 SASI_Mm01_00200363 predicted 3289
13 SASI_Mm01_00200365 predicted 3561
14 SASI_Mm01_00200368 predicted 3690
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016474
CCDC174 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 174
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016474.4-1728s21c1
Sequence:CCGGGCGATAGAATAGAAGTATTTACTCGAGTAAATACTTCTATTCTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016474.4-578s21c1
Sequence:CCGGGTGGATTACGTGGACTCTTTGCTCGAGCAAAGAGTCCACGTAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016474.4-1698s21c1
Sequence:CCGGGACATACCTACCTGGATTTACCTCGAGGTAAATCCAGGTAGGTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016474.4-1904s21c1
Sequence:CCGGACCATAGGTCACGAGGAATTTCTCGAGAAATTCCTCGTGACCTATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016474.3-423s1c1
Sequence:CCGGGAAGATCATAGACAAGCGCAACTCGAGTTGCGCTTGTCTATGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016474.3-769s1c1
Sequence:CCGGCCCGTACATTATGAAGACATTCTCGAGAATGTCTTCATAATGTACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016474.3-1970s1c1
Sequence:CCGGCGGAAGTAATCACATAGGAAACTCGAGTTTCCTATGTGATTACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016474.3-1441s1c1
Sequence:CCGGCTGGATGACATGATTTCCTATCTCGAGATAGGAAATCATGTCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016474.3-1092s1c1
Sequence:CCGGCCAGAGTAGCAAAGTAGAAGTCTCGAGACTTCTACTTTGCTACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016474.3-1785s1c1
Sequence:CCGGCCCACGACTTACTCATATTTACTCGAGTAAATATGAGTAAGTCGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016474
CCDC174 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 174
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016474.4-1728s21c1
Sequence:CCGGGCGATAGAATAGAAGTATTTACTCGAGTAAATACTTCTATTCTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016474.4-578s21c1
Sequence:CCGGGTGGATTACGTGGACTCTTTGCTCGAGCAAAGAGTCCACGTAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016474.4-1698s21c1
Sequence:CCGGGACATACCTACCTGGATTTACCTCGAGGTAAATCCAGGTAGGTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016474.4-1904s21c1
Sequence:CCGGACCATAGGTCACGAGGAATTTCTCGAGAAATTCCTCGTGACCTATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016474.3-423s1c1
Sequence:CCGGGAAGATCATAGACAAGCGCAACTCGAGTTGCGCTTGTCTATGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016474.3-769s1c1
Sequence:CCGGCCCGTACATTATGAAGACATTCTCGAGAATGTCTTCATAATGTACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016474.3-1970s1c1
Sequence:CCGGCGGAAGTAATCACATAGGAAACTCGAGTTTCCTATGTGATTACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016474.3-1441s1c1
Sequence:CCGGCTGGATGACATGATTTCCTATCTCGAGATAGGAAATCATGTCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016474.3-1092s1c1
Sequence:CCGGCCAGAGTAGCAAAGTAGAAGTCTCGAGACTTCTACTTTGCTACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016474.3-1785s1c1
Sequence:CCGGCCCACGACTTACTCATATTTACTCGAGTAAATATGAGTAAGTCGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016474
CCDC174 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 174
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016474.4-1728s21c1
Sequence:CCGGGCGATAGAATAGAAGTATTTACTCGAGTAAATACTTCTATTCTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016474.4-578s21c1
Sequence:CCGGGTGGATTACGTGGACTCTTTGCTCGAGCAAAGAGTCCACGTAATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016474.4-1698s21c1
Sequence:CCGGGACATACCTACCTGGATTTACCTCGAGGTAAATCCAGGTAGGTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016474.4-1904s21c1
Sequence:CCGGACCATAGGTCACGAGGAATTTCTCGAGAAATTCCTCGTGACCTATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016474.3-423s1c1
Sequence:CCGGGAAGATCATAGACAAGCGCAACTCGAGTTGCGCTTGTCTATGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016474.3-769s1c1
Sequence:CCGGCCCGTACATTATGAAGACATTCTCGAGAATGTCTTCATAATGTACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016474.3-1970s1c1
Sequence:CCGGCGGAAGTAATCACATAGGAAACTCGAGTTTCCTATGTGATTACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016474.3-1441s1c1
Sequence:CCGGCTGGATGACATGATTTCCTATCTCGAGATAGGAAATCATGTCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016474.3-1092s1c1
Sequence:CCGGCCAGAGTAGCAAAGTAGAAGTCTCGAGACTTCTACTTTGCTACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016474.3-1785s1c1
Sequence:CCGGCCCACGACTTACTCATATTTACTCGAGTAAATATGAGTAAGTCGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172730
VALIDATED
CCDC174 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 174
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172730.2-413s1c1
Sequence:CCGGGGACATGTACCTTGTGGATTTCTCGAGAAATCCACAAGGTACATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172730.2-286s1c1
Sequence:CCGGCAGAGAAAGATGCGGAACAAACTCGAGTTTGTTCCGCATCTTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172730.1-3921s1c1
Sequence:CCGGCAAATTACTTTGTGGGTCAAACTCGAGTTTGACCCACAAAGTAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172730.1-3140s1c1
Sequence:CCGGCAAATCGAGGAAGAGAGAGATCTCGAGATCTCTCTCTTCCTCGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172730.1-4175s1c1
Sequence:CCGGGAAGTCAGTCAGGACTGAGTTCTCGAGAACTCAGTCCTGACTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172730.1-3853s1c1
Sequence:CCGGCTTTGGATTCTGGTCGAAGAACTCGAGTTCTTCGACCAGAATCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172730.1-3501s1c1
Sequence:CCGGCCCGAGACAAAGAGTTAAGAACTCGAGTTCTTAACTCTTTGTCTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172730
VALIDATED
CCDC174 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 174
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172730.2-413s1c1
Sequence:CCGGGGACATGTACCTTGTGGATTTCTCGAGAAATCCACAAGGTACATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172730.2-286s1c1
Sequence:CCGGCAGAGAAAGATGCGGAACAAACTCGAGTTTGTTCCGCATCTTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172730.1-3921s1c1
Sequence:CCGGCAAATTACTTTGTGGGTCAAACTCGAGTTTGACCCACAAAGTAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172730.1-3140s1c1
Sequence:CCGGCAAATCGAGGAAGAGAGAGATCTCGAGATCTCTCTCTTCCTCGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172730.1-4175s1c1
Sequence:CCGGGAAGTCAGTCAGGACTGAGTTCTCGAGAACTCAGTCCTGACTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172730.1-3853s1c1
Sequence:CCGGCTTTGGATTCTGGTCGAAGAACTCGAGTTCTTCGACCAGAATCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172730.1-3501s1c1
Sequence:CCGGCCCGAGACAAAGAGTTAAGAACTCGAGTTCTTAACTCTTTGTCTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172730
VALIDATED
CCDC174 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 174
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172730.2-413s1c1
Sequence:CCGGGGACATGTACCTTGTGGATTTCTCGAGAAATCCACAAGGTACATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172730.2-286s1c1
Sequence:CCGGCAGAGAAAGATGCGGAACAAACTCGAGTTTGTTCCGCATCTTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172730.1-3921s1c1
Sequence:CCGGCAAATTACTTTGTGGGTCAAACTCGAGTTTGACCCACAAAGTAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172730.1-3140s1c1
Sequence:CCGGCAAATCGAGGAAGAGAGAGATCTCGAGATCTCTCTCTTCCTCGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173330    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172730.1-4175s1c1
Sequence:CCGGGAAGTCAGTCAGGACTGAGTTCTCGAGAACTCAGTCCTGACTGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172730.1-3853s1c1
Sequence:CCGGCTTTGGATTCTGGTCGAAGAACTCGAGTTCTTCGACCAGAATCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172730.1-3501s1c1
Sequence:CCGGCCCGAGACAAAGAGTTAAGAACTCGAGTTCTTAACTCTTTGTCTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks