EMAIL THIS PAGE TO A FRIEND

CCDC175

coiled-coil domain containing 175

84 Gene Product Result for
Synonyms: C14orf38 c14_5395
UniProtKB ID: P0C221, G3V5J7
Gene ID:
Mouse(73936) coiled-coil domain containing 175
Rat(500668) coiled-coil domain containing 175
cow(617691) coiled-coil domain containing 175
domestic cat(101100220) coiled-coil domain containing 175
dog(611244) coiled-coil domain containing 175
naked mole-rat(101706070) coiled-coil domain containing 175
domestic guinea pig(100728255) coiled-coil domain containing 175
sheep(101117082) coiled-coil domain containing 175
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA004200 Anti-CCDC175 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_916831 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_916831 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_916831 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001723715 Rosetta Predictions human pricing
XM_001726944 Rosetta Predictions human pricing
XM_001726950 Rosetta Predictions human pricing
XM_001080587 Rosetta Predictions rat pricing
XM_576045 Rosetta Predictions rat pricing
XM_916831 Rosetta Predictions mouse pricing
XM_982478 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00457101 predicted 326
2 SASI_Hs02_00457102 predicted 2244
3 SASI_Hs02_00457103 predicted 403
4 SASI_Hs02_00457104 predicted 1070
5 SASI_Hs02_00457105 predicted 985
6 SASI_Hs02_00457106 predicted 299
7 SASI_Hs02_00457107 predicted 210
8 SASI_Hs02_00457108 predicted 1242
9 SASI_Hs02_00457109 predicted 280
10 SASI_Hs02_00457110 predicted 834
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00477605 predicted 327
2 SASI_Hs02_00477606 predicted 2242
3 SASI_Hs02_00477607 predicted 408
4 SASI_Hs02_00477608 predicted 1069
5 SASI_Hs02_00477609 predicted 983
6 SASI_Hs02_00477610 predicted 305
7 SASI_Hs02_00477611 predicted 215
8 SASI_Hs02_00477612 predicted 1245
9 SASI_Hs02_00477613 predicted 287
10 SASI_Hs02_00477614 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726950 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00477640 predicted 2250
2 SASI_Hs02_00477641 predicted 864
3 SASI_Hs02_00477642 predicted 1417
4 SASI_Hs02_00477643 predicted 1454
5 SASI_Hs02_00477644 predicted 1467
6 SASI_Hs02_00477645 predicted 1335
7 SASI_Hs02_00477646 predicted 1238
8 SASI_Hs02_00477647 predicted 1513
9 SASI_Hs02_00477648 predicted 834
10 SASI_Hs02_00477649 predicted 1605
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080587 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368533 predicted 495
2 SASI_Rn02_00368534 predicted 1234
3 SASI_Rn02_00368535 predicted 798
4 SASI_Rn02_00368536 predicted 1494
5 SASI_Rn02_00368537 predicted 2144
6 SASI_Rn02_00368538 predicted 2623
7 SASI_Rn02_00368539 predicted 2442
8 SASI_Rn02_00368540 predicted 2365
9 SASI_Rn02_00368541 predicted 1128
10 SASI_Rn02_00368542 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576045 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404679 predicted 1228
2 SASI_Rn02_00404680 predicted 1497
3 SASI_Rn02_00404681 predicted 2145
4 SASI_Rn02_00404682 predicted 1217
5 SASI_Rn02_00404683 predicted 2440
6 SASI_Rn02_00404684 predicted 1983
7 SASI_Rn02_00404685 predicted 2369
8 SASI_Rn02_00404686 predicted 2176
9 SASI_Rn02_00404687 predicted 1303
10 SASI_Rn02_00404688 predicted 2306
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_916831 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00440661 predicted 451
2 SASI_Mm02_00440662 predicted 1544
3 SASI_Mm02_00440663 predicted 1352
4 SASI_Mm02_00440664 predicted 688
5 SASI_Mm02_00440665 predicted 1215
6 SASI_Mm02_00440666 predicted 1343
7 SASI_Mm02_00440667 predicted 2145
8 SASI_Mm02_00440668 predicted 869
9 SASI_Mm02_00440669 predicted 1145
10 SASI_Mm02_00440670 predicted 1509
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_982478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00447835 predicted 446
2 SASI_Mm01_00241657 predicted 1543
3 SASI_Mm01_00241658 predicted 1354
4 SASI_Mm02_00447836 predicted 684
5 SASI_Mm02_00447837 predicted 693
6 SASI_Mm01_00241661 predicted 1217
7 SASI_Mm01_00241662 predicted 1338
8 SASI_Mm02_00447838 predicted 519
9 SASI_Mm02_00447839 predicted 860
10 SASI_Mm02_00447840 predicted 1137
11 SASI_Mm01_00241659 predicted 970
12 SASI_Mm01_00241660 predicted 997
13 SASI_Mm01_00241663 predicted 1378
14 SASI_Mm01_00241664 predicted 1366
15 SASI_Mm01_00241665 predicted 1328
16 SASI_Mm01_00241666 predicted 1198
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_916831
CCDC175 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 175
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000225932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_916831.3-334s21c1
Sequence:CCGGCATGGAGCTGAGCCGACTTTACTCGAGTAAAGTCGGCTCAGCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_916831.3-752s21c1
Sequence:CCGGTATCTGGCTATCCGCATTAAACTCGAGTTTAATGCGGATAGCCAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_916831.3-2333s21c1
Sequence:CCGGTCACCGGCCAGCCTTAGTAAACTCGAGTTTACTAAGGCTGGCCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_916831.3-1050s21c1
Sequence:GTACCGGAGAAGAATGCATTCGTGAATACTCGAGTATTCACGAATGCATTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_916831.3-694s21c1
Sequence:GTACCGGGCAAGAGACAACTCAATTAATCTCGAGATTAATTGAGTTGTCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_916831
CCDC175 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 175
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000225932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_916831.3-334s21c1
Sequence:CCGGCATGGAGCTGAGCCGACTTTACTCGAGTAAAGTCGGCTCAGCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_916831.3-752s21c1
Sequence:CCGGTATCTGGCTATCCGCATTAAACTCGAGTTTAATGCGGATAGCCAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_916831.3-2333s21c1
Sequence:CCGGTCACCGGCCAGCCTTAGTAAACTCGAGTTTACTAAGGCTGGCCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_916831.3-1050s21c1
Sequence:GTACCGGAGAAGAATGCATTCGTGAATACTCGAGTATTCACGAATGCATTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_916831.3-694s21c1
Sequence:GTACCGGGCAAGAGACAACTCAATTAATCTCGAGATTAATTGAGTTGTCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_916831
CCDC175 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 175
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000225932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_916831.3-334s21c1
Sequence:CCGGCATGGAGCTGAGCCGACTTTACTCGAGTAAAGTCGGCTCAGCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_916831.3-752s21c1
Sequence:CCGGTATCTGGCTATCCGCATTAAACTCGAGTTTAATGCGGATAGCCAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_916831.3-2333s21c1
Sequence:CCGGTCACCGGCCAGCCTTAGTAAACTCGAGTTTACTAAGGCTGGCCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_916831.3-1050s21c1
Sequence:GTACCGGAGAAGAATGCATTCGTGAATACTCGAGTATTCACGAATGCATTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_916831.3-694s21c1
Sequence:GTACCGGGCAAGAGACAACTCAATTAATCTCGAGATTAATTGAGTTGTCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks