EMAIL THIS PAGE TO A FRIEND

CCDC176

coiled-coil domain containing 176

88 Gene Product Result for
Synonyms: C14orf45
UniProtKB ID: Q8ND07, Q0P604, Q9H5P8
Gene ID:
Mouse(72873) coiled-coil domain containing 176
Rat(500693) coiled-coil domain containing 176
sheep(101105921) coiled-coil domain containing 176
cow(100137993) coiled-coil domain containing 176
domestic cat(101090525) coiled-coil domain containing 176
dog(611882) coiled-coil domain containing 176
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025057 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025057 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025057 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028377 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028377 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028377 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025057 Rosetta Predictions human pricing
NM_001134631 Rosetta Predictions rat pricing
NM_028377 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025057 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063496 predicted 1360
2 SASI_Hs02_00357715 predicted 828
3 SASI_Hs01_00063497 predicted 1705
4 SASI_Hs01_00063498 predicted 1540
5 SASI_Hs01_00063502 predicted 1334
6 SASI_Hs02_00357716 predicted 1345
7 SASI_Hs01_00063503 predicted 1255
8 SASI_Hs01_00063504 predicted 1169
9 SASI_Hs02_00357717 predicted 946
10 SASI_Hs02_00357718 predicted 1305
11 SASI_Hs01_00063499 predicted 747
12 SASI_Hs01_00063500 predicted 628
13 SASI_Hs01_00063501 predicted 798
14 SASI_Hs01_00063505 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134631 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257789 predicted 999
2 SASI_Rn02_00257790 predicted 375
3 SASI_Rn02_00257791 predicted 516
4 SASI_Rn02_00257792 predicted 472
5 SASI_Rn02_00257793 predicted 237
6 SASI_Rn02_00257794 predicted 295
7 SASI_Rn02_00257795 predicted 375
8 SASI_Rn02_00257796 predicted 837
9 SASI_Rn02_00257797 predicted 911
10 SASI_Rn02_00257798 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028377 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078477 predicted 1469
2 SASI_Mm01_00078478 predicted 343
3 SASI_Mm01_00078479 predicted 1132
4 SASI_Mm01_00078480 predicted 230
5 SASI_Mm01_00078481 predicted 212
6 SASI_Mm02_00333751 predicted 487
7 SASI_Mm01_00078482 predicted 1044
8 SASI_Mm02_00333752 predicted 924
9 SASI_Mm01_00078483 predicted 1648
10 SASI_Mm01_00078484 predicted 1620
11 SASI_Mm01_00078475 predicted 356
12 SASI_Mm01_00078476 predicted 762
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025057
CCDC176 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 176
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025057.2-880s21c1
Sequence:CCGGTTGCAAGAGAGTCATACTTTACTCGAGTAAAGTATGACTCTCTTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025057.2-1061s21c1
Sequence:CCGGTGCAGCAACACGCAATGATAGCTCGAGCTATCATTGCGTGTTGCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025057.2-1278s21c1
Sequence:CCGGACAAGCTGCTTTCAATTTAAACTCGAGTTTAAATTGAAAGCAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025057.2-270s21c1
Sequence:CCGGTAGGATTAAGTATCGTGATACCTCGAGGTATCACGATACTTAATCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025057.2-2552s21c1
Sequence:CCGGCTTCCAAGTTACCAATCATATCTCGAGATATGATTGGTAACTTGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166908    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025057.1-1862s1c1
Sequence:CCGGCCCAAATATGTCTGTATGTTTCTCGAGAAACATACAGACATATTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025057.1-302s1c1
Sequence:CCGGGCAGATAGCACAAGCTGCTTTCTCGAGAAAGCAGCTTGTGCTATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025057
CCDC176 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 176
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025057.2-880s21c1
Sequence:CCGGTTGCAAGAGAGTCATACTTTACTCGAGTAAAGTATGACTCTCTTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025057.2-1061s21c1
Sequence:CCGGTGCAGCAACACGCAATGATAGCTCGAGCTATCATTGCGTGTTGCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025057.2-1278s21c1
Sequence:CCGGACAAGCTGCTTTCAATTTAAACTCGAGTTTAAATTGAAAGCAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025057.2-270s21c1
Sequence:CCGGTAGGATTAAGTATCGTGATACCTCGAGGTATCACGATACTTAATCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025057.2-2552s21c1
Sequence:CCGGCTTCCAAGTTACCAATCATATCTCGAGATATGATTGGTAACTTGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166908    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025057.1-1862s1c1
Sequence:CCGGCCCAAATATGTCTGTATGTTTCTCGAGAAACATACAGACATATTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025057.1-302s1c1
Sequence:CCGGGCAGATAGCACAAGCTGCTTTCTCGAGAAAGCAGCTTGTGCTATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025057
CCDC176 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 176
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025057.2-880s21c1
Sequence:CCGGTTGCAAGAGAGTCATACTTTACTCGAGTAAAGTATGACTCTCTTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025057.2-1061s21c1
Sequence:CCGGTGCAGCAACACGCAATGATAGCTCGAGCTATCATTGCGTGTTGCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025057.2-1278s21c1
Sequence:CCGGACAAGCTGCTTTCAATTTAAACTCGAGTTTAAATTGAAAGCAGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025057.2-270s21c1
Sequence:CCGGTAGGATTAAGTATCGTGATACCTCGAGGTATCACGATACTTAATCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025057.2-2552s21c1
Sequence:CCGGCTTCCAAGTTACCAATCATATCTCGAGATATGATTGGTAACTTGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166908    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025057.1-1862s1c1
Sequence:CCGGCCCAAATATGTCTGTATGTTTCTCGAGAAACATACAGACATATTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025057.1-302s1c1
Sequence:CCGGGCAGATAGCACAAGCTGCTTTCTCGAGAAAGCAGCTTGTGCTATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028377
CCDC176 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 176
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028377.1-493s1c1
Sequence:CCGGGCCAAGGAAATCGGCATGATTCTCGAGAATCATGCCGATTTCCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028377.1-1297s1c1
Sequence:CCGGCCCAGAATCAGGACCTTTGATCTCGAGATCAAAGGTCCTGATTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028377.1-1688s1c1
Sequence:CCGGGCAGATGACTCCACAGTAGATCTCGAGATCTACTGTGGAGTCATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028377.1-1751s1c1
Sequence:CCGGCAAGACAGTTTCTCAAAGAAACTCGAGTTTCTTTGAGAAACTGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028377.1-1781s1c1
Sequence:CCGGCCAGCTCAAAGGTTACCTGTTCTCGAGAACAGGTAACCTTTGAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028377
CCDC176 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 176
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028377.1-493s1c1
Sequence:CCGGGCCAAGGAAATCGGCATGATTCTCGAGAATCATGCCGATTTCCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028377.1-1297s1c1
Sequence:CCGGCCCAGAATCAGGACCTTTGATCTCGAGATCAAAGGTCCTGATTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028377.1-1688s1c1
Sequence:CCGGGCAGATGACTCCACAGTAGATCTCGAGATCTACTGTGGAGTCATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028377.1-1751s1c1
Sequence:CCGGCAAGACAGTTTCTCAAAGAAACTCGAGTTTCTTTGAGAAACTGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028377.1-1781s1c1
Sequence:CCGGCCAGCTCAAAGGTTACCTGTTCTCGAGAACAGGTAACCTTTGAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028377
CCDC176 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 176
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028377.1-493s1c1
Sequence:CCGGGCCAAGGAAATCGGCATGATTCTCGAGAATCATGCCGATTTCCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028377.1-1297s1c1
Sequence:CCGGCCCAGAATCAGGACCTTTGATCTCGAGATCAAAGGTCCTGATTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028377.1-1688s1c1
Sequence:CCGGGCAGATGACTCCACAGTAGATCTCGAGATCTACTGTGGAGTCATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192014    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028377.1-1751s1c1
Sequence:CCGGCAAGACAGTTTCTCAAAGAAACTCGAGTTTCTTTGAGAAACTGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028377.1-1781s1c1
Sequence:CCGGCCAGCTCAAAGGTTACCTGTTCTCGAGAACAGGTAACCTTTGAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)