EMAIL THIS PAGE TO A FRIEND

CCDC177

coiled-coil domain containing 177

75 Gene Product Result for
Synonyms: C14orf162 PLPL
UniProtKB ID: Q9NQR7, B2R5G1, Q2M359
Gene ID:
Mouse(380768) coiled-coil domain containing 177
Rat(500686) coiled-coil domain containing 177
chicken(101668509) coiled-coil domain containing 177
cow(101906537) coiled-coil domain containing 177
chicken(101748318) coiled-coil domain containing 177
naked mole-rat(101729423) coiled-coil domain containing 177
domestic guinea pig(100723103) coiled-coil domain containing 177
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008423 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001008423 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001008423 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020181 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020181 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020181 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020181 Rosetta Predictions human pricing
XR_040527 Rosetta Predictions human pricing
XR_040528 Rosetta Predictions human pricing
XR_040529 Rosetta Predictions human pricing
XM_001053824 Rosetta Predictions rat pricing
XM_576068 Rosetta Predictions rat pricing
NM_001008423 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046468 predicted 649
2 SASI_Hs01_00046469 predicted 681
3 SASI_Hs01_00046470 predicted 645
4 SASI_Hs01_00046471 predicted 675
5 SASI_Hs01_00046472 predicted 737
6 SASI_Hs01_00046473 predicted 856
7 SASI_Hs01_00046474 predicted 746
8 SASI_Hs01_00046475 predicted 707
9 SASI_Hs01_00046476 predicted 754
10 SASI_Hs01_00046477 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00519693 predicted 562
2 SASI_Hs02_00519694 predicted 269
3 SASI_Hs02_00519695 predicted 316
4 SASI_Hs02_00519696 predicted 259
5 SASI_Hs02_00519697 predicted 117
6 SASI_Hs02_00519698 predicted 382
7 SASI_Hs02_00519699 predicted 288
8 SASI_Hs02_00519700 predicted 263
9 SASI_Hs02_00519701 predicted 296
10 SASI_Hs02_00519702 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040528 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00519703 predicted 561
2 SASI_Hs02_00519704 predicted 272
3 SASI_Hs02_00519705 predicted 315
4 SASI_Hs02_00519706 predicted 263
5 SASI_Hs02_00519707 predicted 117
6 SASI_Hs02_00519708 predicted 381
7 SASI_Hs02_00519709 predicted 284
8 SASI_Hs02_00519710 predicted 263
9 SASI_Hs02_00519711 predicted 298
10 SASI_Hs02_00519712 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00519713 predicted 570
2 SASI_Hs02_00519714 predicted 273
3 SASI_Hs02_00519715 predicted 316
4 SASI_Hs02_00519716 predicted 262
5 SASI_Hs02_00519717 predicted 122
6 SASI_Hs02_00519718 predicted 378
7 SASI_Hs02_00519719 predicted 286
8 SASI_Hs02_00519720 predicted 259
9 SASI_Hs02_00519721 predicted 296
10 SASI_Hs02_00519722 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053824 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273705 predicted 1953
2 SASI_Rn02_00273706 predicted 2880
3 SASI_Rn02_00273707 predicted 2510
4 SASI_Rn02_00273708 predicted 2905
5 SASI_Rn02_00273709 predicted 2352
6 SASI_Rn02_00273710 predicted 2854
7 SASI_Rn02_00273711 predicted 2918
8 SASI_Rn02_00273712 predicted 2774
9 SASI_Rn02_00273713 predicted 2591
10 SASI_Rn02_00273714 predicted 2925
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576068 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404709 predicted 1949
2 SASI_Rn02_00404710 predicted 2885
3 SASI_Rn02_00404711 predicted 2501
4 SASI_Rn02_00404712 predicted 2910
5 SASI_Rn02_00404713 predicted 2349
6 SASI_Rn02_00404714 predicted 2852
7 SASI_Rn02_00404715 predicted 2916
8 SASI_Rn02_00404716 predicted 2780
9 SASI_Rn02_00404717 predicted 2585
10 SASI_Rn02_00404718 predicted 2917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008423 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179625 predicted 2575
2 SASI_Mm02_00286789 predicted 2606
3 SASI_Mm01_00179626 predicted 2651
4 SASI_Mm01_00179627 predicted 2858
5 SASI_Mm01_00179629 predicted 2850
6 SASI_Mm01_00179630 predicted 2549
7 SASI_Mm01_00179631 predicted 2808
8 SASI_Mm01_00179632 predicted 2562
9 SASI_Mm01_00179633 predicted 1183
10 SASI_Mm01_00179634 predicted 2151
11 SASI_Mm01_00179628 predicted 2873
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008423
CCDC177 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 177
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000181857    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008423.1-2898s1c1
Sequence:CCGGGCACAGCTCGTCTAAGATGTTCTCGAGAACATCTTAGACGAGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008423.1-3653s1c1
Sequence:CCGGCCAAAGCATCACTTCAGTGTTCTCGAGAACACTGAAGTGATGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008423.1-3018s1c1
Sequence:CCGGGCTTTCTAGTTAGACAATCATCTCGAGATGATTGTCTAACTAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008423.1-526s1c1
Sequence:CCGGGCACCTCGATCTCTTCAATTTCTCGAGAAATTGAAGAGATCGAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008423
CCDC177 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 177
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000181857    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008423.1-2898s1c1
Sequence:CCGGGCACAGCTCGTCTAAGATGTTCTCGAGAACATCTTAGACGAGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008423.1-3653s1c1
Sequence:CCGGCCAAAGCATCACTTCAGTGTTCTCGAGAACACTGAAGTGATGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008423.1-3018s1c1
Sequence:CCGGGCTTTCTAGTTAGACAATCATCTCGAGATGATTGTCTAACTAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008423.1-526s1c1
Sequence:CCGGGCACCTCGATCTCTTCAATTTCTCGAGAAATTGAAGAGATCGAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008423
CCDC177 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 177
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000181857    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008423.1-2898s1c1
Sequence:CCGGGCACAGCTCGTCTAAGATGTTCTCGAGAACATCTTAGACGAGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008423.1-3653s1c1
Sequence:CCGGCCAAAGCATCACTTCAGTGTTCTCGAGAACACTGAAGTGATGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008423.1-3018s1c1
Sequence:CCGGGCTTTCTAGTTAGACAATCATCTCGAGATGATTGTCTAACTAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008423.1-526s1c1
Sequence:CCGGGCACCTCGATCTCTTCAATTTCTCGAGAAATTGAAGAGATCGAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020181
CCDC177 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 177
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020181.1-411s1c1
Sequence:CCGGGCACAGGAAATTGGTTGGTTTCTCGAGAAACCAACCAATTTCCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020181.1-1040s1c1
Sequence:CCGGCCTAGTTTCTTTCTGGGAATACTCGAGTATTCCCAGAAAGAAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020181.1-289s1c1
Sequence:CCGGGAGCAAATTCTCACCAGTTATCTCGAGATAACTGGTGAGAATTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020181.1-405s1c1
Sequence:CCGGCAAGTGGCACAGGAAATTGGTCTCGAGACCAATTTCCTGTGCCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122816    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020181.1-756s1c1
Sequence:CCGGGCCTTTGTTGAGAGTTGTGTTCTCGAGAACACAACTCTCAACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020181
CCDC177 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 177
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020181.1-411s1c1
Sequence:CCGGGCACAGGAAATTGGTTGGTTTCTCGAGAAACCAACCAATTTCCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020181.1-1040s1c1
Sequence:CCGGCCTAGTTTCTTTCTGGGAATACTCGAGTATTCCCAGAAAGAAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020181.1-289s1c1
Sequence:CCGGGAGCAAATTCTCACCAGTTATCTCGAGATAACTGGTGAGAATTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020181.1-405s1c1
Sequence:CCGGCAAGTGGCACAGGAAATTGGTCTCGAGACCAATTTCCTGTGCCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122816    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020181.1-756s1c1
Sequence:CCGGGCCTTTGTTGAGAGTTGTGTTCTCGAGAACACAACTCTCAACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020181
CCDC177 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 177
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020181.1-411s1c1
Sequence:CCGGGCACAGGAAATTGGTTGGTTTCTCGAGAAACCAACCAATTTCCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020181.1-1040s1c1
Sequence:CCGGCCTAGTTTCTTTCTGGGAATACTCGAGTATTCCCAGAAAGAAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020181.1-289s1c1
Sequence:CCGGGAGCAAATTCTCACCAGTTATCTCGAGATAACTGGTGAGAATTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020181.1-405s1c1
Sequence:CCGGCAAGTGGCACAGGAAATTGGTCTCGAGACCAATTTCCTGTGCCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122816    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020181.1-756s1c1
Sequence:CCGGGCCTTTGTTGAGAGTTGTGTTCTCGAGAACACAACTCTCAACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks