EMAIL THIS PAGE TO A FRIEND

CCDC178

coiled-coil domain containing 178

Synonyms: C18orf34
UniProtKB ID: Q5BJE1, A6NDC6, Q6ZP67, Q6ZU20
Gene ID:
Mouse(70950) coiled coil domain containing 178
Rat(307556) coiled-coil domain containing 178
domestic guinea pig(100733432) coiled-coil domain containing 178
naked mole-rat(101698134) coiled-coil domain containing 178
sheep(101117383) coiled-coil domain containing 178
cow(532148) coiled-coil domain containing 178
dog(490493) coiled-coil domain containing 178
128 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198995 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198995 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198995 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027616 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027616 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027616 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030701 MISSION® esiRNA esiRNA human C18orf34 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105528 Rosetta Predictions human pricing
NM_198995 Rosetta Predictions human pricing
XM_001055112 Rosetta Predictions rat pricing
XM_226130 Rosetta Predictions rat pricing
NM_027616 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105528 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324201 predicted 1680
2 SASI_Hs02_00324202 predicted 2667
3 SASI_Hs02_00324203 predicted 263
4 SASI_Hs02_00324204 predicted 715
5 SASI_Hs02_00324205 predicted 533
6 SASI_Hs02_00324206 predicted 2807
7 SASI_Hs02_00324207 predicted 282
8 SASI_Hs02_00324208 predicted 2828
9 SASI_Hs02_00324209 predicted 539
10 SASI_Hs02_00324210 predicted 1724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198995 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372508 predicted 1751
2 SASI_Hs01_00096566 predicted 2621
3 SASI_Hs02_00372509 predicted 333
4 SASI_Hs01_00096568 predicted 783
5 SASI_Hs01_00096569 predicted 606
6 SASI_Hs01_00096570 predicted 2756
7 SASI_Hs02_00372510 predicted 346
8 SASI_Hs01_00096571 predicted 2784
9 SASI_Hs01_00096572 predicted 609
10 SASI_Hs02_00372511 predicted 1794
11 SASI_Hs01_00096564 predicted 324
12 SASI_Hs01_00096565 predicted 791
13 SASI_Hs01_00096567 predicted 2446
14 SASI_Hs01_00096573 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055112 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278492 predicted 1328
2 SASI_Rn02_00278493 predicted 901
3 SASI_Rn02_00278494 predicted 546
4 SASI_Rn02_00278495 predicted 797
5 SASI_Rn02_00278496 predicted 257
6 SASI_Rn02_00278497 predicted 2319
7 SASI_Rn02_00278498 predicted 1239
8 SASI_Rn02_00278499 predicted 1141
9 SASI_Rn02_00278500 predicted 755
10 SASI_Rn02_00278501 predicted 1432
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226130 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383360 predicted 1324
2 SASI_Rn02_00383361 predicted 895
3 SASI_Rn02_00383362 predicted 887
4 SASI_Rn02_00383363 predicted 553
5 SASI_Rn02_00383364 predicted 793
6 SASI_Rn02_00383365 predicted 254
7 SASI_Rn02_00383366 predicted 375
8 SASI_Rn02_00383367 predicted 1234
9 SASI_Rn02_00383368 predicted 751
10 SASI_Rn02_00383369 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027616 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063005 predicted 407
2 SASI_Mm01_00063006 predicted 492
3 SASI_Mm01_00063007 predicted 472
4 SASI_Mm02_00332456 predicted 2398
5 SASI_Mm01_00063008 predicted 2810
6 SASI_Mm01_00063009 predicted 310
7 SASI_Mm01_00063011 predicted 1136
8 SASI_Mm01_00063012 predicted 912
9 SASI_Mm01_00063013 predicted 469
10 SASI_Mm01_00063014 predicted 380
11 SASI_Mm01_00063010 predicted 2284
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198995
CCDC178 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 178
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198995.1-1850s1c1
Sequence:CCGGGCTGGAATGGTGCTTCAGAAACTCGAGTTTCTGAAGCACCATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198995.1-678s1c1
Sequence:CCGGGTCCAGAGTTAAAGCAGGAAACTCGAGTTTCCTGCTTTAACTCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134877    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198995.1-2711s1c1
Sequence:CCGGCAATGTATCTTGGATGCTGAACTCGAGTTCAGCATCCAAGATACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198995.1-1970s1c1
Sequence:CCGGCTGCTTCAACTAGAAGATGAACTCGAGTTCATCTTCTAGTTGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198995.1-336s1c1
Sequence:CCGGCCATGTCTCAAAGTTTGGTTACTCGAGTAACCAAACTTTGAGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135767    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198995.1-2710s1c1
Sequence:CCGGCCAATGTATCTTGGATGCTGACTCGAGTCAGCATCCAAGATACATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198995.1-875s1c1
Sequence:CCGGGAGGCCTATTTGAGTGATGTTCTCGAGAACATCACTCAAATAGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136236    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198995.1-2792s1c1
Sequence:CCGGGCCATTTCACACTTCCATGAACTCGAGTTCATGGAAGTGTGAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198995.2-2898s21c1
Sequence:CCGGTGCTGTCAGGAACGATCTAATCTCGAGATTAGATCGTTCCTGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198995.2-1226s21c1
Sequence:CCGGGCCTACAAGAGAGAGATATATCTCGAGATATATCTCTCTCTTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198995
CCDC178 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 178
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198995.1-1850s1c1
Sequence:CCGGGCTGGAATGGTGCTTCAGAAACTCGAGTTTCTGAAGCACCATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198995.1-678s1c1
Sequence:CCGGGTCCAGAGTTAAAGCAGGAAACTCGAGTTTCCTGCTTTAACTCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134877    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198995.1-2711s1c1
Sequence:CCGGCAATGTATCTTGGATGCTGAACTCGAGTTCAGCATCCAAGATACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198995.1-1970s1c1
Sequence:CCGGCTGCTTCAACTAGAAGATGAACTCGAGTTCATCTTCTAGTTGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198995.1-336s1c1
Sequence:CCGGCCATGTCTCAAAGTTTGGTTACTCGAGTAACCAAACTTTGAGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135767    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198995.1-2710s1c1
Sequence:CCGGCCAATGTATCTTGGATGCTGACTCGAGTCAGCATCCAAGATACATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198995.1-875s1c1
Sequence:CCGGGAGGCCTATTTGAGTGATGTTCTCGAGAACATCACTCAAATAGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136236    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198995.1-2792s1c1
Sequence:CCGGGCCATTTCACACTTCCATGAACTCGAGTTCATGGAAGTGTGAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198995.2-2898s21c1
Sequence:CCGGTGCTGTCAGGAACGATCTAATCTCGAGATTAGATCGTTCCTGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198995.2-1226s21c1
Sequence:CCGGGCCTACAAGAGAGAGATATATCTCGAGATATATCTCTCTCTTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198995
CCDC178 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 178
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198995.1-1850s1c1
Sequence:CCGGGCTGGAATGGTGCTTCAGAAACTCGAGTTTCTGAAGCACCATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198995.1-678s1c1
Sequence:CCGGGTCCAGAGTTAAAGCAGGAAACTCGAGTTTCCTGCTTTAACTCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134877    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198995.1-2711s1c1
Sequence:CCGGCAATGTATCTTGGATGCTGAACTCGAGTTCAGCATCCAAGATACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198995.1-1970s1c1
Sequence:CCGGCTGCTTCAACTAGAAGATGAACTCGAGTTCATCTTCTAGTTGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198995.1-336s1c1
Sequence:CCGGCCATGTCTCAAAGTTTGGTTACTCGAGTAACCAAACTTTGAGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135767    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198995.1-2710s1c1
Sequence:CCGGCCAATGTATCTTGGATGCTGACTCGAGTCAGCATCCAAGATACATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198995.1-875s1c1
Sequence:CCGGGAGGCCTATTTGAGTGATGTTCTCGAGAACATCACTCAAATAGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136236    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198995.1-2792s1c1
Sequence:CCGGGCCATTTCACACTTCCATGAACTCGAGTTCATGGAAGTGTGAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198995.2-2898s21c1
Sequence:CCGGTGCTGTCAGGAACGATCTAATCTCGAGATTAGATCGTTCCTGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198995.2-1226s21c1
Sequence:CCGGGCCTACAAGAGAGAGATATATCTCGAGATATATCTCTCTCTTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027616
CCDC178 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 178
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027616.1-2397s1c1
Sequence:CCGGCCTGCGTTTAGCCAAAGAATACTCGAGTATTCTTTGGCTAAACGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027616.1-2553s1c1
Sequence:CCGGGCAAGAATACTTCCGACTGATCTCGAGATCAGTCGGAAGTATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027616.1-1939s1c1
Sequence:CCGGCACTCTAAGATGCTGCATAATCTCGAGATTATGCAGCATCTTAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027616.2-2927s21c1
Sequence:CCGGCGCTGTCAGGAACGATCTAATCTCGAGATTAGATCGTTCCTGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027616.2-2164s21c1
Sequence:CCGGACCTAGAAAGGACGAACTATGCTCGAGCATAGTTCGTCCTTTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027616.2-1837s21c1
Sequence:CCGGTACGAAGACAAGTACTCTATACTCGAGTATAGAGTACTTGTCTTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027616.2-978s21c1
Sequence:CCGGCTGAAAGAGCGTTACCATAAACTCGAGTTTATGGTAACGCTCTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027616.2-1939s21c1
Sequence:CCGGACTCTAAGATGCTGCATAATACTCGAGTATTATGCAGCATCTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027616
CCDC178 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 178
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027616.1-2397s1c1
Sequence:CCGGCCTGCGTTTAGCCAAAGAATACTCGAGTATTCTTTGGCTAAACGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027616.1-2553s1c1
Sequence:CCGGGCAAGAATACTTCCGACTGATCTCGAGATCAGTCGGAAGTATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027616.1-1939s1c1
Sequence:CCGGCACTCTAAGATGCTGCATAATCTCGAGATTATGCAGCATCTTAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027616.2-2927s21c1
Sequence:CCGGCGCTGTCAGGAACGATCTAATCTCGAGATTAGATCGTTCCTGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027616.2-2164s21c1
Sequence:CCGGACCTAGAAAGGACGAACTATGCTCGAGCATAGTTCGTCCTTTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027616.2-1837s21c1
Sequence:CCGGTACGAAGACAAGTACTCTATACTCGAGTATAGAGTACTTGTCTTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027616.2-978s21c1
Sequence:CCGGCTGAAAGAGCGTTACCATAAACTCGAGTTTATGGTAACGCTCTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027616.2-1939s21c1
Sequence:CCGGACTCTAAGATGCTGCATAATACTCGAGTATTATGCAGCATCTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027616
CCDC178 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 178
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027616.1-2397s1c1
Sequence:CCGGCCTGCGTTTAGCCAAAGAATACTCGAGTATTCTTTGGCTAAACGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027616.1-2553s1c1
Sequence:CCGGGCAAGAATACTTCCGACTGATCTCGAGATCAGTCGGAAGTATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027616.1-1939s1c1
Sequence:CCGGCACTCTAAGATGCTGCATAATCTCGAGATTATGCAGCATCTTAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027616.2-2927s21c1
Sequence:CCGGCGCTGTCAGGAACGATCTAATCTCGAGATTAGATCGTTCCTGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027616.2-2164s21c1
Sequence:CCGGACCTAGAAAGGACGAACTATGCTCGAGCATAGTTCGTCCTTTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027616.2-1837s21c1
Sequence:CCGGTACGAAGACAAGTACTCTATACTCGAGTATAGAGTACTTGTCTTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027616.2-978s21c1
Sequence:CCGGCTGAAAGAGCGTTACCATAAACTCGAGTTTATGGTAACGCTCTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027616.2-1939s21c1
Sequence:CCGGACTCTAAGATGCTGCATAATACTCGAGTATTATGCAGCATCTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks