EMAIL THIS PAGE TO A FRIEND

CCDC17

coiled-coil domain containing 17

74 Gene Product Result for
Gene ID:
Mouse(622665) coiled-coil domain containing 17
Rat(500528) coiled-coil domain containing 17
chicken(424601) coiled-coil domain containing 17
dog(100684386) coiled-coil domain containing 17
domestic cat(101080987) coiled-coil domain containing 17
cow(515836) coiled-coil domain containing 17
naked mole-rat(101711807) coiled-coil domain containing 17
domestic guinea pig(100722493) coiled-coil domain containing 17
sheep(101111597) coiled-coil domain containing 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152500 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152500 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152500 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001037916 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001037916 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001037916 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114938 Rosetta Predictions human pricing
NM_152500 Rosetta Predictions human pricing
NM_001014067 Rosetta Predictions rat pricing
XM_575889 Rosetta Predictions rat pricing
NM_001037916 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326844 predicted 223
2 SASI_Hs02_00326845 predicted 1610
3 SASI_Hs02_00326846 predicted 970
4 SASI_Hs02_00326847 predicted 342
5 SASI_Hs02_00326848 predicted 1516
6 SASI_Hs02_00326849 predicted 1905
7 SASI_Hs02_00326850 predicted 333
8 SASI_Hs02_00326851 predicted 214
9 SASI_Hs02_00326852 predicted 1316
10 SASI_Hs02_00326853 predicted 1432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060819 predicted 693
2 SASI_Hs01_00060820 predicted 1236
3 SASI_Hs01_00060821 predicted 1628
4 SASI_Hs01_00060822 predicted 1334
5 SASI_Hs01_00060823 predicted 1243
6 SASI_Hs01_00060824 predicted 701
7 SASI_Hs01_00060825 predicted 1043
8 SASI_Hs01_00060826 predicted 1157
9 SASI_Hs01_00060827 predicted 1053
10 SASI_Hs01_00060828 predicted 1275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014067 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084384 predicted 875
2 SASI_Rn02_00201463 predicted 1048
3 SASI_Rn02_00201464 predicted 817
4 SASI_Rn02_00201465 predicted 1406
5 SASI_Rn02_00201466 predicted 1590
6 SASI_Rn02_00201467 predicted 1443
7 SASI_Rn02_00201468 predicted 919
8 SASI_Rn01_00084392 predicted 469
9 SASI_Rn02_00201469 predicted 1135
10 SASI_Rn02_00201470 predicted 1712
11 SASI_Rn01_00084383 predicted 967
12 SASI_Rn01_00084385 predicted 934
13 SASI_Rn01_00084386 predicted 1208
14 SASI_Rn01_00084387 predicted 1113
15 SASI_Rn01_00084388 predicted 333
16 SASI_Rn01_00084389 predicted 1010
17 SASI_Rn01_00084390 predicted 393
18 SASI_Rn01_00084391 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575889 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00176470 predicted 808
2 SASI_Rn01_00176471 predicted 379
3 SASI_Rn01_00176472 predicted 428
4 SASI_Rn01_00176473 predicted 444
5 SASI_Rn01_00176474 predicted 277
6 SASI_Rn01_00176475 predicted 816
7 SASI_Rn01_00176476 predicted 456
8 SASI_Rn01_00176477 predicted 321
9 SASI_Rn01_00176478 predicted 355
10 SASI_Rn01_00176479 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037916 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138511 predicted 985
2 SASI_Mm01_00138512 predicted 732
3 SASI_Mm01_00138513 predicted 831
4 SASI_Mm01_00138514 predicted 995
5 SASI_Mm01_00138515 predicted 1008
6 SASI_Mm01_00138516 predicted 1137
7 SASI_Mm01_00138517 predicted 1358
8 SASI_Mm02_00289519 predicted 1232
9 SASI_Mm01_00138518 predicted 1770
10 SASI_Mm01_00138519 predicted 1371
11 SASI_Mm01_00138510 predicted 1733
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152500
CCDC17 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 17
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152500.1-1716s1c1
Sequence:CCGGGCAGAGATCAATCCAGCAAGTCTCGAGACTTGCTGGATTGATCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152500.1-267s1c1
Sequence:CCGGCAAGTGATGACATTTGGAGCACTCGAGTGCTCCAAATGTCATCACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152500.1-738s1c1
Sequence:CCGGGAACTTTATTCTCCAGTGCAACTCGAGTTGCACTGGAGAATAAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152500.1-1285s1c1
Sequence:CCGGCCTGGATTTGGGTGCAACTAACTCGAGTTAGTTGCACCCAAATCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152500.1-615s1c1
Sequence:CCGGCAGGAGATTCGAGAACTACAACTCGAGTTGTAGTTCTCGAATCTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152500.1-1854s1c1
Sequence:CCGGGCCAGTCATTACCAATGCTTTCTCGAGAAAGCATTGGTAATGACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152500.1-1453s1c1
Sequence:CCGGCATCATCAGTATCTTTGGTCTCTCGAGAGACCAAAGATACTGATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152500
CCDC17 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 17
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152500.1-1716s1c1
Sequence:CCGGGCAGAGATCAATCCAGCAAGTCTCGAGACTTGCTGGATTGATCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152500.1-267s1c1
Sequence:CCGGCAAGTGATGACATTTGGAGCACTCGAGTGCTCCAAATGTCATCACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152500.1-738s1c1
Sequence:CCGGGAACTTTATTCTCCAGTGCAACTCGAGTTGCACTGGAGAATAAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152500.1-1285s1c1
Sequence:CCGGCCTGGATTTGGGTGCAACTAACTCGAGTTAGTTGCACCCAAATCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152500.1-615s1c1
Sequence:CCGGCAGGAGATTCGAGAACTACAACTCGAGTTGTAGTTCTCGAATCTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152500.1-1854s1c1
Sequence:CCGGGCCAGTCATTACCAATGCTTTCTCGAGAAAGCATTGGTAATGACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152500.1-1453s1c1
Sequence:CCGGCATCATCAGTATCTTTGGTCTCTCGAGAGACCAAAGATACTGATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152500
CCDC17 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 17
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152500.1-1716s1c1
Sequence:CCGGGCAGAGATCAATCCAGCAAGTCTCGAGACTTGCTGGATTGATCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152500.1-267s1c1
Sequence:CCGGCAAGTGATGACATTTGGAGCACTCGAGTGCTCCAAATGTCATCACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152500.1-738s1c1
Sequence:CCGGGAACTTTATTCTCCAGTGCAACTCGAGTTGCACTGGAGAATAAAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152500.1-1285s1c1
Sequence:CCGGCCTGGATTTGGGTGCAACTAACTCGAGTTAGTTGCACCCAAATCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152500.1-615s1c1
Sequence:CCGGCAGGAGATTCGAGAACTACAACTCGAGTTGTAGTTCTCGAATCTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152500.1-1854s1c1
Sequence:CCGGGCCAGTCATTACCAATGCTTTCTCGAGAAAGCATTGGTAATGACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152500.1-1453s1c1
Sequence:CCGGCATCATCAGTATCTTTGGTCTCTCGAGAGACCAAAGATACTGATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037916
CCDC17 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 17
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037916.3-1815s21c1
Sequence:CCGGCCAACTACATTTGATCCTAAACTCGAGTTTAGGATCAAATGTAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037916.3-197s21c1
Sequence:CCGGAGCCTTCAGTCGCGATCAAACCTCGAGGTTTGATCGCGACTGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037916.3-1155s21c1
Sequence:CCGGTTGGATATGGGTACAGCTAATCTCGAGATTAGCTGTACCCATATCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037916.3-523s21c1
Sequence:CCGGCAAACGCTAGGTGCGCATTTCCTCGAGGAAATGCGCACCTAGCGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037916.3-1318s21c1
Sequence:CCGGCCATCACCACTGGTATCTTTGCTCGAGCAAAGATACCAGTGGTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037916
CCDC17 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 17
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037916.3-1815s21c1
Sequence:CCGGCCAACTACATTTGATCCTAAACTCGAGTTTAGGATCAAATGTAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037916.3-197s21c1
Sequence:CCGGAGCCTTCAGTCGCGATCAAACCTCGAGGTTTGATCGCGACTGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037916.3-1155s21c1
Sequence:CCGGTTGGATATGGGTACAGCTAATCTCGAGATTAGCTGTACCCATATCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037916.3-523s21c1
Sequence:CCGGCAAACGCTAGGTGCGCATTTCCTCGAGGAAATGCGCACCTAGCGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037916.3-1318s21c1
Sequence:CCGGCCATCACCACTGGTATCTTTGCTCGAGCAAAGATACCAGTGGTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037916
CCDC17 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 17
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037916.3-1815s21c1
Sequence:CCGGCCAACTACATTTGATCCTAAACTCGAGTTTAGGATCAAATGTAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037916.3-197s21c1
Sequence:CCGGAGCCTTCAGTCGCGATCAAACCTCGAGGTTTGATCGCGACTGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037916.3-1155s21c1
Sequence:CCGGTTGGATATGGGTACAGCTAATCTCGAGATTAGCTGTACCCATATCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037916.3-523s21c1
Sequence:CCGGCAAACGCTAGGTGCGCATTTCCTCGAGGAAATGCGCACCTAGCGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037916.3-1318s21c1
Sequence:CCGGCCATCACCACTGGTATCTTTGCTCGAGCAAAGATACCAGTGGTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)