EMAIL THIS PAGE TO A FRIEND

CCDC181

coiled-coil domain containing 181

65 Gene Product Result for
Synonyms: C1orf114 RP1-206D15.2
UniProtKB ID: Q5TID7, O60780, Q53FD5, Q5TID9, Q8TC48
Gene ID:
Mouse(74895) coiled-coil domain containing 181
Rat(360867) coiled-coil domain containing 181
dog(480082) coiled-coil domain containing 181
cow(540268) coiled-coil domain containing 181
naked mole-rat(101717742) coiled-coil domain containing 181
domestic guinea pig(100716906) coiled-coil domain containing 181
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021179 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021179 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021179 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029115 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029115 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029115 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021179 Rosetta Predictions human pricing
NM_001014131 Rosetta Predictions rat pricing
NM_029115 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226192 predicted 346
2 SASI_Hs01_00226193 predicted 410
3 SASI_Hs01_00226195 predicted 926
4 SASI_Hs01_00226196 predicted 447
5 SASI_Hs01_00226197 predicted 525
6 SASI_Hs01_00226198 predicted 353
7 SASI_Hs01_00226199 predicted 395
8 SASI_Hs01_00226200 predicted 1626
9 SASI_Hs02_00354746 predicted 576
10 SASI_Hs02_00354747 predicted 883
11 SASI_Hs01_00226194 predicted 205
12 SASI_Hs01_00226201 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014131 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031994 predicted 835
2 SASI_Rn01_00031995 predicted 1228
3 SASI_Rn01_00031996 predicted 696
4 SASI_Rn01_00031998 predicted 912
5 SASI_Rn01_00031999 predicted 549
6 SASI_Rn01_00032000 predicted 1208
7 SASI_Rn01_00032002 predicted 284
8 SASI_Rn02_00201584 predicted 917
9 SASI_Rn01_00032003 predicted 522
10 SASI_Rn02_00201585 predicted 852
11 SASI_Rn01_00031997 predicted 1013
12 SASI_Rn01_00032001 predicted 1029
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029115 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174370 predicted 274
2 SASI_Mm01_00174371 predicted 1478
3 SASI_Mm01_00174372 predicted 415
4 SASI_Mm01_00174373 predicted 1556
5 SASI_Mm01_00174374 predicted 749
6 SASI_Mm01_00174375 predicted 542
7 SASI_Mm01_00174376 predicted 973
8 SASI_Mm01_00174377 predicted 1361
9 SASI_Mm01_00174378 predicted 867
10 SASI_Mm01_00174379 predicted 318
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021179
CCDC181 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 181
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021179.1-1607s1c1
Sequence:CCGGGACTAGAAGCTAAGCGTTCTACTCGAGTAGAACGCTTAGCTTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021179.1-396s1c1
Sequence:CCGGCTCACCAAGAAGAAATGACATCTCGAGATGTCATTTCTTCTTGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021179.1-448s1c1
Sequence:CCGGCCCATATCAGATTCAGATAGTCTCGAGACTATCTGAATCTGATATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021179.1-714s1c1
Sequence:CCGGGTTTGGGAAACTGTCACAATTCTCGAGAATTGTGACAGTTTCCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021179.1-659s1c1
Sequence:CCGGCTCCACTAGAAGACACTACTACTCGAGTAGTAGTGTCTTCTAGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021179.1-427s1c1
Sequence:CCGGCCAGGTATTCAACCTTTGGATCTCGAGATCCAAAGGTTGAATACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021179.1-1615s1c1
Sequence:CCGGGCTAAGCGTTCTAAACAGTTACTCGAGTAACTGTTTAGAACGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021179.1-1366s1c1
Sequence:CCGGGAAGACATGAACAGTAGAGAACTCGAGTTCTCTACTGTTCATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021179.1-272s1c1
Sequence:CCGGCCAGCATAATAGAGATGGCTTCTCGAGAAGCCATCTCTATTATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021179
CCDC181 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 181
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021179.1-1607s1c1
Sequence:CCGGGACTAGAAGCTAAGCGTTCTACTCGAGTAGAACGCTTAGCTTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021179.1-396s1c1
Sequence:CCGGCTCACCAAGAAGAAATGACATCTCGAGATGTCATTTCTTCTTGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021179.1-448s1c1
Sequence:CCGGCCCATATCAGATTCAGATAGTCTCGAGACTATCTGAATCTGATATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021179.1-714s1c1
Sequence:CCGGGTTTGGGAAACTGTCACAATTCTCGAGAATTGTGACAGTTTCCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021179.1-659s1c1
Sequence:CCGGCTCCACTAGAAGACACTACTACTCGAGTAGTAGTGTCTTCTAGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021179.1-427s1c1
Sequence:CCGGCCAGGTATTCAACCTTTGGATCTCGAGATCCAAAGGTTGAATACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021179.1-1615s1c1
Sequence:CCGGGCTAAGCGTTCTAAACAGTTACTCGAGTAACTGTTTAGAACGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021179.1-1366s1c1
Sequence:CCGGGAAGACATGAACAGTAGAGAACTCGAGTTCTCTACTGTTCATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021179.1-272s1c1
Sequence:CCGGCCAGCATAATAGAGATGGCTTCTCGAGAAGCCATCTCTATTATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021179
CCDC181 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 181
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021179.1-1607s1c1
Sequence:CCGGGACTAGAAGCTAAGCGTTCTACTCGAGTAGAACGCTTAGCTTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021179.1-396s1c1
Sequence:CCGGCTCACCAAGAAGAAATGACATCTCGAGATGTCATTTCTTCTTGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021179.1-448s1c1
Sequence:CCGGCCCATATCAGATTCAGATAGTCTCGAGACTATCTGAATCTGATATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021179.1-714s1c1
Sequence:CCGGGTTTGGGAAACTGTCACAATTCTCGAGAATTGTGACAGTTTCCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021179.1-659s1c1
Sequence:CCGGCTCCACTAGAAGACACTACTACTCGAGTAGTAGTGTCTTCTAGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021179.1-427s1c1
Sequence:CCGGCCAGGTATTCAACCTTTGGATCTCGAGATCCAAAGGTTGAATACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021179.1-1615s1c1
Sequence:CCGGGCTAAGCGTTCTAAACAGTTACTCGAGTAACTGTTTAGAACGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021179.1-1366s1c1
Sequence:CCGGGAAGACATGAACAGTAGAGAACTCGAGTTCTCTACTGTTCATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021179.1-272s1c1
Sequence:CCGGCCAGCATAATAGAGATGGCTTCTCGAGAAGCCATCTCTATTATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029115
VALIDATED
CCDC181 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 181
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029115.1-731s1c1
Sequence:CCGGCTGGGAAACTGTCCCAGTTATCTCGAGATAACTGGGACAGTTTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029115.1-1366s1c1
Sequence:CCGGGCAAAGCAGATCGAAGACATTCTCGAGAATGTCTTCGATCTGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029115.1-416s1c1
Sequence:CCGGCCAGAAGGAATGATTTCATTTCTCGAGAAATGAAATCATTCCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029115.1-691s1c1
Sequence:CCGGGATACTTGTAAAGCTCTCTTACTCGAGTAAGAGAGCTTTACAAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029115.1-1470s1c1
Sequence:CCGGGAAGACAGAAGAACTCAGAAACTCGAGTTTCTGAGTTCTTCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181457    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029115.1-1717s1c1
Sequence:CCGGCACCAGGGAAAGACTACATGTCTCGAGACATGTAGTCTTTCCCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029115.1-442s1c1
Sequence:CCGGCCAAGTATTCAGCCGTTGGATCTCGAGATCCAACGGCTGAATACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029115.1-1096s1c1
Sequence:CCGGGCCAACCCAGATGTAACTAAACTCGAGTTTAGTTACATCTGGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029115.3-454s21c1
Sequence:CCGGTTCAGCCGTTGGATCCCATATCTCGAGATATGGGATCCAACGGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029115.3-257s21c1
Sequence:CCGGGGAGTGGTTGATCAATGATAACTCGAGTTATCATTGATCAACCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029115.3-1538s21c1
Sequence:CCGGCGAGAGAGCCTTTCGACAATGCTCGAGCATTGTCGAAAGGCTCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029115.3-552s21c1
Sequence:CCGGGAAGTAAGGAGATACATTATGCTCGAGCATAATGTATCTCCTTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029115
VALIDATED
CCDC181 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 181
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029115.1-731s1c1
Sequence:CCGGCTGGGAAACTGTCCCAGTTATCTCGAGATAACTGGGACAGTTTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029115.1-1366s1c1
Sequence:CCGGGCAAAGCAGATCGAAGACATTCTCGAGAATGTCTTCGATCTGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029115.1-416s1c1
Sequence:CCGGCCAGAAGGAATGATTTCATTTCTCGAGAAATGAAATCATTCCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029115.1-691s1c1
Sequence:CCGGGATACTTGTAAAGCTCTCTTACTCGAGTAAGAGAGCTTTACAAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029115.1-1470s1c1
Sequence:CCGGGAAGACAGAAGAACTCAGAAACTCGAGTTTCTGAGTTCTTCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181457    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029115.1-1717s1c1
Sequence:CCGGCACCAGGGAAAGACTACATGTCTCGAGACATGTAGTCTTTCCCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029115.1-442s1c1
Sequence:CCGGCCAAGTATTCAGCCGTTGGATCTCGAGATCCAACGGCTGAATACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029115.1-1096s1c1
Sequence:CCGGGCCAACCCAGATGTAACTAAACTCGAGTTTAGTTACATCTGGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029115.3-454s21c1
Sequence:CCGGTTCAGCCGTTGGATCCCATATCTCGAGATATGGGATCCAACGGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029115.3-257s21c1
Sequence:CCGGGGAGTGGTTGATCAATGATAACTCGAGTTATCATTGATCAACCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029115.3-1538s21c1
Sequence:CCGGCGAGAGAGCCTTTCGACAATGCTCGAGCATTGTCGAAAGGCTCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029115.3-552s21c1
Sequence:CCGGGAAGTAAGGAGATACATTATGCTCGAGCATAATGTATCTCCTTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029115
VALIDATED
CCDC181 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 181
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029115.1-731s1c1
Sequence:CCGGCTGGGAAACTGTCCCAGTTATCTCGAGATAACTGGGACAGTTTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029115.1-1366s1c1
Sequence:CCGGGCAAAGCAGATCGAAGACATTCTCGAGAATGTCTTCGATCTGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029115.1-416s1c1
Sequence:CCGGCCAGAAGGAATGATTTCATTTCTCGAGAAATGAAATCATTCCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029115.1-691s1c1
Sequence:CCGGGATACTTGTAAAGCTCTCTTACTCGAGTAAGAGAGCTTTACAAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029115.1-1470s1c1
Sequence:CCGGGAAGACAGAAGAACTCAGAAACTCGAGTTTCTGAGTTCTTCTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181457    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029115.1-1717s1c1
Sequence:CCGGCACCAGGGAAAGACTACATGTCTCGAGACATGTAGTCTTTCCCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029115.1-442s1c1
Sequence:CCGGCCAAGTATTCAGCCGTTGGATCTCGAGATCCAACGGCTGAATACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029115.1-1096s1c1
Sequence:CCGGGCCAACCCAGATGTAACTAAACTCGAGTTTAGTTACATCTGGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029115.3-454s21c1
Sequence:CCGGTTCAGCCGTTGGATCCCATATCTCGAGATATGGGATCCAACGGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029115.3-257s21c1
Sequence:CCGGGGAGTGGTTGATCAATGATAACTCGAGTTATCATTGATCAACCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029115.3-1538s21c1
Sequence:CCGGCGAGAGAGCCTTTCGACAATGCTCGAGCATTGTCGAAAGGCTCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029115.3-552s21c1
Sequence:CCGGGAAGTAAGGAGATACATTATGCTCGAGCATAATGTATCTCCTTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks