EMAIL THIS PAGE TO A FRIEND

CCDC18

coiled-coil domain containing 18

85 Gene Product Result for
Synonyms: NY-SAR-41 dJ717I23.1
UniProtKB ID: Q5T9S5, Q6ZU17
Gene ID:
Mouse(73254) coiled-coil domain containing 18
Rat(305628) coiled-coil domain containing 18
chicken(424497) coiled-coil domain containing 18
dog(479946) coiled-coil domain containing 18
Horse(100059470) coiled-coil domain containing 18
domestic cat(101098560) coiled-coil domain containing 18
sheep(101117639) coiled-coil domain containing 18
Domestic Rabbit(100339080) coiled-coil domain containing 18
naked mole-rat(101696459) coiled-coil domain containing 18
domestic guinea pig(100723779) coiled-coil domain containing 18
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA028035 Anti-CCDC18 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028481 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028481 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028481 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_206886 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_206886 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_206886 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_206886 Rosetta Predictions human pricing
XM_001060717 Rosetta Predictions rat pricing
XM_223734 Rosetta Predictions rat pricing
NM_028481 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206886 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099312 predicted 2099
2 SASI_Hs02_00373577 predicted 3065
3 SASI_Hs01_00099315 predicted 1768
4 SASI_Hs02_00373578 predicted 2482
5 SASI_Hs01_00099316 predicted 2047
6 SASI_Hs02_00373579 predicted 3743
7 SASI_Hs01_00099317 predicted 521
8 SASI_Hs01_00099318 predicted 3873
9 SASI_Hs01_00099319 predicted 2590
10 SASI_Hs02_00373580 predicted 2166
11 SASI_Hs01_00099311 predicted 4047
12 SASI_Hs01_00099313 predicted 2926
13 SASI_Hs01_00099314 predicted 915
14 SASI_Hs01_00099320 predicted 2685
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060717 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297463 predicted 1654
2 SASI_Rn02_00297464 predicted 2813
3 SASI_Rn02_00297465 predicted 239
4 SASI_Rn02_00297466 predicted 498
5 SASI_Rn02_00297467 predicted 4143
6 SASI_Rn02_00297468 predicted 907
7 SASI_Rn02_00297469 predicted 1135
8 SASI_Rn02_00297470 predicted 4065
9 SASI_Rn02_00297471 predicted 3870
10 SASI_Rn02_00297472 predicted 3110
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223734 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381640 predicted 4417
2 SASI_Rn02_00381641 predicted 4463
3 SASI_Rn02_00381642 predicted 4411
4 SASI_Rn02_00381643 predicted 4414
5 SASI_Rn02_00381644 predicted 4538
6 SASI_Rn02_00381645 predicted 4552
7 SASI_Rn02_00381646 predicted 4448
8 SASI_Rn02_00381647 predicted 4351
9 SASI_Rn02_00381648 predicted 4391
10 SASI_Rn02_00381649 predicted 4454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028481 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333949 predicted 2254
2 SASI_Mm01_00141180 predicted 1728
3 SASI_Mm01_00141182 predicted 3146
4 SASI_Mm02_00333950 predicted 2504
5 SASI_Mm01_00141183 predicted 996
6 SASI_Mm01_00141184 predicted 801
7 SASI_Mm02_00333951 predicted 466
8 SASI_Mm01_00141186 predicted 1284
9 SASI_Mm01_00141188 predicted 2446
10 SASI_Mm01_00141189 predicted 756
11 SASI_Mm01_00141181 predicted 368
12 SASI_Mm01_00141185 predicted 391
13 SASI_Mm01_00141187 predicted 1524
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028481
CCDC18 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 18
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028481.1-4504s1c1
Sequence:CCGGGCTGTTTGTTATGTGTATGTACTCGAGTACATACACATAACAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028481.1-323s1c1
Sequence:CCGGCGTTTGATTTACCCACCTTATCTCGAGATAAGGTGGGTAAATCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028481.1-3317s1c1
Sequence:CCGGGCCAAAGAACAGCTTCGAGAACTCGAGTTCTCGAAGCTGTTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028481.1-225s1c1
Sequence:CCGGCCAGTGTTAGTCCAAGTGAAACTCGAGTTTCACTTGGACTAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028481.1-2116s1c1
Sequence:CCGGGCAGCAAGATATACTGTGTAACTCGAGTTACACAGTATATCTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028481
CCDC18 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 18
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028481.1-4504s1c1
Sequence:CCGGGCTGTTTGTTATGTGTATGTACTCGAGTACATACACATAACAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028481.1-323s1c1
Sequence:CCGGCGTTTGATTTACCCACCTTATCTCGAGATAAGGTGGGTAAATCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028481.1-3317s1c1
Sequence:CCGGGCCAAAGAACAGCTTCGAGAACTCGAGTTCTCGAAGCTGTTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028481.1-225s1c1
Sequence:CCGGCCAGTGTTAGTCCAAGTGAAACTCGAGTTTCACTTGGACTAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028481.1-2116s1c1
Sequence:CCGGGCAGCAAGATATACTGTGTAACTCGAGTTACACAGTATATCTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028481
CCDC18 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 18
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028481.1-4504s1c1
Sequence:CCGGGCTGTTTGTTATGTGTATGTACTCGAGTACATACACATAACAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028481.1-323s1c1
Sequence:CCGGCGTTTGATTTACCCACCTTATCTCGAGATAAGGTGGGTAAATCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028481.1-3317s1c1
Sequence:CCGGGCCAAAGAACAGCTTCGAGAACTCGAGTTCTCGAAGCTGTTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028481.1-225s1c1
Sequence:CCGGCCAGTGTTAGTCCAAGTGAAACTCGAGTTTCACTTGGACTAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028481.1-2116s1c1
Sequence:CCGGGCAGCAAGATATACTGTGTAACTCGAGTTACACAGTATATCTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206886
CCDC18 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 18
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206886.1-2067s1c1
Sequence:CCGGCGGGAAGTACTTGAGACTGAACTCGAGTTCAGTCTCAAGTACTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206886.1-1932s1c1
Sequence:CCGGGCAATGCACTTCTCTCAATTACTCGAGTAATTGAGAGAAGTGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206886.1-2725s1c1
Sequence:CCGGGAGAAATAGAAAGGCTCTCTACTCGAGTAGAGAGCCTTTCTATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206886.1-2988s1c1
Sequence:CCGGCAGCAACTAAACGAACAGTTACTCGAGTAACTGTTCGTTTAGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206886.1-2466s1c1
Sequence:CCGGGCTAAAGAACAGCTTCGAGAACTCGAGTTCTCGAAGCTGTTCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206886.1-491s1c1
Sequence:CCGGCCAGATGAGTAGCTTCTCAAACTCGAGTTTGAGAAGCTACTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206886.1-330s1c1
Sequence:CCGGCGAGAATTAAAGGTCCGTGTTCTCGAGAACACGGACCTTTAATTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206886.1-1045s1c1
Sequence:CCGGCAGAACTAGAACAGGAGCTTACTCGAGTAAGCTCCTGTTCTAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206886.1-705s1c1
Sequence:CCGGCCTGTAAAGCTAGGTGGTCATCTCGAGATGACCACCTAGCTTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206886.1-354s1c1
Sequence:CCGGGCACAGAATGAGCGACTAGATCTCGAGATCTAGTCGCTCATTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206886
CCDC18 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 18
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206886.1-2067s1c1
Sequence:CCGGCGGGAAGTACTTGAGACTGAACTCGAGTTCAGTCTCAAGTACTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206886.1-1932s1c1
Sequence:CCGGGCAATGCACTTCTCTCAATTACTCGAGTAATTGAGAGAAGTGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206886.1-2725s1c1
Sequence:CCGGGAGAAATAGAAAGGCTCTCTACTCGAGTAGAGAGCCTTTCTATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206886.1-2988s1c1
Sequence:CCGGCAGCAACTAAACGAACAGTTACTCGAGTAACTGTTCGTTTAGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206886.1-2466s1c1
Sequence:CCGGGCTAAAGAACAGCTTCGAGAACTCGAGTTCTCGAAGCTGTTCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206886.1-491s1c1
Sequence:CCGGCCAGATGAGTAGCTTCTCAAACTCGAGTTTGAGAAGCTACTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206886.1-330s1c1
Sequence:CCGGCGAGAATTAAAGGTCCGTGTTCTCGAGAACACGGACCTTTAATTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206886.1-1045s1c1
Sequence:CCGGCAGAACTAGAACAGGAGCTTACTCGAGTAAGCTCCTGTTCTAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206886.1-705s1c1
Sequence:CCGGCCTGTAAAGCTAGGTGGTCATCTCGAGATGACCACCTAGCTTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206886.1-354s1c1
Sequence:CCGGGCACAGAATGAGCGACTAGATCTCGAGATCTAGTCGCTCATTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206886
CCDC18 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 18
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206886.1-2067s1c1
Sequence:CCGGCGGGAAGTACTTGAGACTGAACTCGAGTTCAGTCTCAAGTACTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206886.1-1932s1c1
Sequence:CCGGGCAATGCACTTCTCTCAATTACTCGAGTAATTGAGAGAAGTGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206886.1-2725s1c1
Sequence:CCGGGAGAAATAGAAAGGCTCTCTACTCGAGTAGAGAGCCTTTCTATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206886.1-2988s1c1
Sequence:CCGGCAGCAACTAAACGAACAGTTACTCGAGTAACTGTTCGTTTAGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206886.1-2466s1c1
Sequence:CCGGGCTAAAGAACAGCTTCGAGAACTCGAGTTCTCGAAGCTGTTCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206886.1-491s1c1
Sequence:CCGGCCAGATGAGTAGCTTCTCAAACTCGAGTTTGAGAAGCTACTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206886.1-330s1c1
Sequence:CCGGCGAGAATTAAAGGTCCGTGTTCTCGAGAACACGGACCTTTAATTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206886.1-1045s1c1
Sequence:CCGGCAGAACTAGAACAGGAGCTTACTCGAGTAAGCTCCTGTTCTAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_206886.1-705s1c1
Sequence:CCGGCCTGTAAAGCTAGGTGGTCATCTCGAGATGACCACCTAGCTTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206886.1-354s1c1
Sequence:CCGGGCACAGAATGAGCGACTAGATCTCGAGATCTAGTCGCTCATTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks