EMAIL THIS PAGE TO A FRIEND

CCDC19

coiled-coil domain containing 19

63 Gene Product Result for
Synonyms: NESG1
UniProtKB ID: Q9UL16, Q5VU18
Gene ID:
Mouse(71870) coiled-coil domain containing 19
Rat(304984) coiled-coil domain containing 19
domestic guinea pig(100720691) coiled-coil domain containing 19
naked mole-rat(101726694) coiled-coil domain containing 19
sheep(101116271) coiled-coil domain containing 19
Zebrafish(325276) coiled-coil domain containing 19
chicken(426452) coiled-coil domain containing 19
dog(488632) coiled-coil domain containing 19
cow(617350) coiled-coil domain containing 19
Horse(100057891) coiled-coil domain containing 19
domestic cat(101092082) coiled-coil domain containing 19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027972 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027972 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027972 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012337 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012337 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012337 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU219691 MISSION® esiRNA esiRNA targeting human CCDC19 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012337 Rosetta Predictions human pricing
NM_001024882 Rosetta Predictions rat pricing
XM_001002046 Rosetta Predictions mouse pricing
XM_355284 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100740 predicted 329
2 SASI_Hs02_00344136 predicted 1088
3 SASI_Hs01_00100741 predicted 913
4 SASI_Hs01_00100742 predicted 447
5 SASI_Hs01_00100744 predicted 1049
6 SASI_Hs01_00100745 predicted 938
7 SASI_Hs01_00100746 predicted 955
8 SASI_Hs01_00100747 predicted 1322
9 SASI_Hs01_00100748 predicted 552
10 SASI_Hs01_00100749 predicted 1534
11 SASI_Hs01_00100743 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024882 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104456 predicted 800
2 SASI_Rn01_00104457 predicted 1035
3 SASI_Rn01_00104458 predicted 1158
4 SASI_Rn01_00104459 predicted 723
5 SASI_Rn01_00104461 predicted 932
6 SASI_Rn01_00104462 predicted 1271
7 SASI_Rn01_00104463 predicted 705
8 SASI_Rn01_00104464 predicted 596
9 SASI_Rn01_00104465 predicted 1534
10 SASI_Rn02_00202765 predicted 1496
11 SASI_Rn01_00104460 predicted 1571
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002046 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00355380 predicted 354
2 SASI_Mm02_00355381 predicted 1367
3 SASI_Mm02_00355382 predicted 476
4 SASI_Mm02_00355383 predicted 192
5 SASI_Mm02_00355384 predicted 461
6 SASI_Mm02_00355385 predicted 290
7 SASI_Mm02_00355386 predicted 449
8 SASI_Mm02_00355387 predicted 928
9 SASI_Mm02_00355388 predicted 722
10 SASI_Mm02_00355389 predicted 1079
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355284 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425823 predicted 1239
2 SASI_Mm01_00236295 predicted 476
3 SASI_Mm01_00236297 predicted 470
4 SASI_Mm02_00425824 predicted 1235
5 SASI_Mm02_00425825 predicted 425
6 SASI_Mm01_00236298 predicted 444
7 SASI_Mm02_00425826 predicted 1269
8 SASI_Mm02_00425827 predicted 1327
9 SASI_Mm02_00425828 predicted 503
10 SASI_Mm02_00425829 predicted 413
11 SASI_Mm01_00236294 predicted 363
12 SASI_Mm01_00236296 predicted 200
13 SASI_Mm01_00236299 predicted 932
14 SASI_Mm01_00236300 predicted 729
15 SASI_Mm01_00236301 predicted 1077
16 SASI_Mm01_00236302 predicted 370
17 SASI_Mm01_00236303 predicted 739
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027972
CCDC19 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 19
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000346714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027972.1-827s21c1
Sequence:CCGGCACATCGTGGAGCAGATAAAGCTCGAGCTTTATCTGCTCCACGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027972.1-1175s21c1
Sequence:CCGGCAGGAGAAGGCGCAGGATTATCTCGAGATAATCCTGCGCCTTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027972
CCDC19 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 19
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000346714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027972.1-827s21c1
Sequence:CCGGCACATCGTGGAGCAGATAAAGCTCGAGCTTTATCTGCTCCACGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027972.1-1175s21c1
Sequence:CCGGCAGGAGAAGGCGCAGGATTATCTCGAGATAATCCTGCGCCTTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027972
CCDC19 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 19
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000346714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027972.1-827s21c1
Sequence:CCGGCACATCGTGGAGCAGATAAAGCTCGAGCTTTATCTGCTCCACGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027972.1-1175s21c1
Sequence:CCGGCAGGAGAAGGCGCAGGATTATCTCGAGATAATCCTGCGCCTTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012337
CCDC19 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 19
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012337.1-1638s1c1
Sequence:CCGGCTTCCCGAGAAGTACTGCATTCTCGAGAATGCAGTACTTCTCGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012337.1-812s1c1
Sequence:CCGGGAATTAGAGGAAGGCGGCAAACTCGAGTTTGCCGCCTTCCTCTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012337.1-754s1c1
Sequence:CCGGGAGCGGCAGAAATCCATTCAACTCGAGTTGAATGGATTTCTGCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012337.1-984s1c1
Sequence:CCGGGCAAGCTGAGATTAAGCGCATCTCGAGATGCGCTTAATCTCAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012337.1-621s1c1
Sequence:CCGGGCTCAAGGACATGAGCAAGATCTCGAGATCTTGCTCATGTCCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012337.1-1641s1c1
Sequence:CCGGCCCGAGAAGTACTGCATTGAACTCGAGTTCAATGCAGTACTTCTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012337.1-913s1c1
Sequence:CCGGGAATATATGGAACAGCTCCAACTCGAGTTGGAGCTGTTCCATATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012337.1-635s1c1
Sequence:CCGGGCAAGATTATCCTCAATGCTACTCGAGTAGCATTGAGGATAATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012337.1-978s1c1
Sequence:CCGGGAAGATGCAAGCTGAGATTAACTCGAGTTAATCTCAGCTTGCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012337.1-988s1c1
Sequence:CCGGGCTGAGATTAAGCGCATCAATCTCGAGATTGATGCGCTTAATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012337.1-1380s1c1
Sequence:CCGGGATGAGTTCGAGAGGATTCTTCTCGAGAAGAATCCTCTCGAACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012337.1-510s1c1
Sequence:CCGGGATGGTGTGGAACAACAACAACTCGAGTTGTTGTTGTTCCACACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012337
CCDC19 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 19
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012337.1-1638s1c1
Sequence:CCGGCTTCCCGAGAAGTACTGCATTCTCGAGAATGCAGTACTTCTCGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012337.1-812s1c1
Sequence:CCGGGAATTAGAGGAAGGCGGCAAACTCGAGTTTGCCGCCTTCCTCTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012337.1-754s1c1
Sequence:CCGGGAGCGGCAGAAATCCATTCAACTCGAGTTGAATGGATTTCTGCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012337.1-984s1c1
Sequence:CCGGGCAAGCTGAGATTAAGCGCATCTCGAGATGCGCTTAATCTCAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012337.1-621s1c1
Sequence:CCGGGCTCAAGGACATGAGCAAGATCTCGAGATCTTGCTCATGTCCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012337.1-1641s1c1
Sequence:CCGGCCCGAGAAGTACTGCATTGAACTCGAGTTCAATGCAGTACTTCTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012337.1-913s1c1
Sequence:CCGGGAATATATGGAACAGCTCCAACTCGAGTTGGAGCTGTTCCATATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012337.1-635s1c1
Sequence:CCGGGCAAGATTATCCTCAATGCTACTCGAGTAGCATTGAGGATAATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012337.1-978s1c1
Sequence:CCGGGAAGATGCAAGCTGAGATTAACTCGAGTTAATCTCAGCTTGCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012337.1-988s1c1
Sequence:CCGGGCTGAGATTAAGCGCATCAATCTCGAGATTGATGCGCTTAATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012337.1-1380s1c1
Sequence:CCGGGATGAGTTCGAGAGGATTCTTCTCGAGAAGAATCCTCTCGAACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012337.1-510s1c1
Sequence:CCGGGATGGTGTGGAACAACAACAACTCGAGTTGTTGTTGTTCCACACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012337
CCDC19 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 19
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012337.1-1638s1c1
Sequence:CCGGCTTCCCGAGAAGTACTGCATTCTCGAGAATGCAGTACTTCTCGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012337.1-812s1c1
Sequence:CCGGGAATTAGAGGAAGGCGGCAAACTCGAGTTTGCCGCCTTCCTCTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012337.1-754s1c1
Sequence:CCGGGAGCGGCAGAAATCCATTCAACTCGAGTTGAATGGATTTCTGCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012337.1-984s1c1
Sequence:CCGGGCAAGCTGAGATTAAGCGCATCTCGAGATGCGCTTAATCTCAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012337.1-621s1c1
Sequence:CCGGGCTCAAGGACATGAGCAAGATCTCGAGATCTTGCTCATGTCCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156251    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012337.1-1641s1c1
Sequence:CCGGCCCGAGAAGTACTGCATTGAACTCGAGTTCAATGCAGTACTTCTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012337.1-913s1c1
Sequence:CCGGGAATATATGGAACAGCTCCAACTCGAGTTGGAGCTGTTCCATATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012337.1-635s1c1
Sequence:CCGGGCAAGATTATCCTCAATGCTACTCGAGTAGCATTGAGGATAATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012337.1-978s1c1
Sequence:CCGGGAAGATGCAAGCTGAGATTAACTCGAGTTAATCTCAGCTTGCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012337.1-988s1c1
Sequence:CCGGGCTGAGATTAAGCGCATCAATCTCGAGATTGATGCGCTTAATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012337.1-1380s1c1
Sequence:CCGGGATGAGTTCGAGAGGATTCTTCTCGAGAAGAATCCTCTCGAACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012337.1-510s1c1
Sequence:CCGGGATGGTGTGGAACAACAACAACTCGAGTTGTTGTTGTTCCACACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks