EMAIL THIS PAGE TO A FRIEND

CCDC22

coiled-coil domain containing 22

62 Gene Product Result for
Synonyms: CXorf37
UniProtKB ID: O60826, A8K7G1
Gene ID:
Human(28952) Summary: This gene encodes a protein containing a coiled-coil domain. The mouse orthologous protein has been shown to bind copines, which are calcium-dependent, membrane-binding proteins that may function in calcium signaling. Localization of the orthologous rat protein suggests that it may play a role in neuronal injury response. This human gene has been identified as a novel candidate gene for syndromic X-linked intellectual disability. [provided by RefSeq, Aug 2011]
Mouse(54638) coiled-coil domain containing 22
Rat(317381) coiled-coil domain containing 22
Zebrafish(556259) coiled-coil domain containing 22
cow(534246) coiled-coil domain containing 22
domestic cat(101081278) coiled-coil domain containing 22
dog(491875) coiled-coil domain containing 22
sheep(101104125) coiled-coil domain containing 22
naked mole-rat(101723012) coiled-coil domain containing 22
domestic guinea pig(100735327) coiled-coil domain containing 22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014008 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014008 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014008 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138603 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138603 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138603 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014008 Rosetta Predictions human pricing
XM_001060019 Rosetta Predictions rat pricing
XM_228770 Rosetta Predictions rat pricing
NM_138603 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014008 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121266 predicted 905
2 SASI_Hs01_00121267 predicted 238
3 SASI_Hs01_00121269 predicted 1750
4 SASI_Hs01_00121270 predicted 397
5 SASI_Hs01_00121271 predicted 1183
6 SASI_Hs01_00121272 predicted 1800
7 SASI_Hs01_00121273 predicted 1554
8 SASI_Hs02_00344979 predicted 223
9 SASI_Hs01_00121274 predicted 1359
10 SASI_Hs01_00121275 predicted 995
11 SASI_Hs01_00121268 predicted 2108
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060019 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295122 predicted 923
2 SASI_Rn02_00295123 predicted 1676
3 SASI_Rn02_00295124 predicted 2023
4 SASI_Rn02_00295125 predicted 1672
5 SASI_Rn02_00295126 predicted 979
6 SASI_Rn02_00295127 predicted 1219
7 SASI_Rn02_00295128 predicted 881
8 SASI_Rn02_00295129 predicted 1543
9 SASI_Rn02_00295130 predicted 1542
10 SASI_Rn02_00295131 predicted 1443
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228770 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385477 predicted 924
2 SASI_Rn02_00385478 predicted 1678
3 SASI_Rn02_00385479 predicted 2022
4 SASI_Rn02_00385480 predicted 1667
5 SASI_Rn02_00385481 predicted 972
6 SASI_Rn02_00385482 predicted 1226
7 SASI_Rn02_00385483 predicted 884
8 SASI_Rn02_00385484 predicted 1540
9 SASI_Rn02_00385485 predicted 1543
10 SASI_Rn02_00385486 predicted 1443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138603 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140370 predicted 633
2 SASI_Mm01_00140371 predicted 1108
3 SASI_Mm02_00339672 predicted 1423
4 SASI_Mm01_00140372 predicted 874
5 SASI_Mm01_00140375 predicted 973
6 SASI_Mm02_00339673 predicted 965
7 SASI_Mm02_00339674 predicted 1153
8 SASI_Mm02_00339675 predicted 1162
9 SASI_Mm02_00339676 predicted 1644
10 SASI_Mm02_00339677 predicted 377
11 SASI_Mm01_00140367 predicted 1125
12 SASI_Mm01_00140368 predicted 345
13 SASI_Mm01_00140369 predicted 1138
14 SASI_Mm01_00140373 predicted 1331
15 SASI_Mm01_00140374 predicted 585
16 SASI_Mm01_00140376 predicted 1367
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014008
VALIDATED
CCDC22 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 22
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014008.1-329s1c1
Sequence:CCGGCTTGGAGCTTGGCTATCAGAACTCGAGTTCTGATAGCCAAGCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014008.1-1604s1c1
Sequence:CCGGGCAGAAGGAAGAGATCACCAACTCGAGTTGGTGATCTCTTCCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014008.1-968s1c1
Sequence:CCGGGCACTCAGAGAAGTTCACCTTCTCGAGAAGGTGAACTTCTCTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014008.1-1709s1c1
Sequence:CCGGGCTTGTGTTCAAGGATGCCAACTCGAGTTGGCATCCTTGAACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014008.1-962s1c1
Sequence:CCGGCTTCACGCACTCAGAGAAGTTCTCGAGAACTTCTCTGAGTGCGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014008.1-1650s1c1
Sequence:CCGGCAGAAGGAAATCAACTCCCTACTCGAGTAGGGAGTTGATTTCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014008.1-1622s1c1
Sequence:CCGGCAAGATCTTGTCTGATACGAACTCGAGTTCGTATCAGACAAGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014008.1-1607s1c1
Sequence:CCGGGAAGGAAGAGATCACCAAGATCTCGAGATCTTGGTGATCTCTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014008.1-1640s1c1
Sequence:CCGGGAAGGAGCTTCAGAAGGAAATCTCGAGATTTCCTTCTGAAGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014008.1-1616s1c1
Sequence:CCGGGATCACCAAGATCTTGTCTGACTCGAGTCAGACAAGATCTTGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014008.1-1704s1c1
Sequence:CCGGGATGAGCTTGTGTTCAAGGATCTCGAGATCCTTGAACACAAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014008.1-1752s1c1
Sequence:CCGGGCCTATAAGTATCTAGCTGCTCTCGAGAGCAGCTAGATACTTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014008.1-1746s1c1
Sequence:CCGGCGGAAGGCCTATAAGTATCTACTCGAGTAGATACTTATAGGCCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014008.2-1774s21c1
Sequence:CCGGGATGAGCTTGTGTTCAAGGATCTCGAGATCCTTGAACACAAGCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014008.2-1710s21c1
Sequence:CCGGGAAGGAGCTTCAGAAGGAAATCTCGAGATTTCCTTCTGAAGCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014008.2-1032s21c1
Sequence:CCGGCTTCACGCACTCAGAGAAGTTCTCGAGAACTTCTCTGAGTGCGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014008.2-1674s21c1
Sequence:CCGGGCAGAAGGAAGAGATCACCAACTCGAGTTGGTGATCTCTTCCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014008
VALIDATED
CCDC22 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 22
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014008.1-329s1c1
Sequence:CCGGCTTGGAGCTTGGCTATCAGAACTCGAGTTCTGATAGCCAAGCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014008.1-1604s1c1
Sequence:CCGGGCAGAAGGAAGAGATCACCAACTCGAGTTGGTGATCTCTTCCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014008.1-968s1c1
Sequence:CCGGGCACTCAGAGAAGTTCACCTTCTCGAGAAGGTGAACTTCTCTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014008.1-1709s1c1
Sequence:CCGGGCTTGTGTTCAAGGATGCCAACTCGAGTTGGCATCCTTGAACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014008.1-962s1c1
Sequence:CCGGCTTCACGCACTCAGAGAAGTTCTCGAGAACTTCTCTGAGTGCGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014008.1-1650s1c1
Sequence:CCGGCAGAAGGAAATCAACTCCCTACTCGAGTAGGGAGTTGATTTCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014008.1-1622s1c1
Sequence:CCGGCAAGATCTTGTCTGATACGAACTCGAGTTCGTATCAGACAAGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014008.1-1607s1c1
Sequence:CCGGGAAGGAAGAGATCACCAAGATCTCGAGATCTTGGTGATCTCTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014008.1-1640s1c1
Sequence:CCGGGAAGGAGCTTCAGAAGGAAATCTCGAGATTTCCTTCTGAAGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014008.1-1616s1c1
Sequence:CCGGGATCACCAAGATCTTGTCTGACTCGAGTCAGACAAGATCTTGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014008.1-1704s1c1
Sequence:CCGGGATGAGCTTGTGTTCAAGGATCTCGAGATCCTTGAACACAAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014008.1-1752s1c1
Sequence:CCGGGCCTATAAGTATCTAGCTGCTCTCGAGAGCAGCTAGATACTTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014008.1-1746s1c1
Sequence:CCGGCGGAAGGCCTATAAGTATCTACTCGAGTAGATACTTATAGGCCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014008.2-1774s21c1
Sequence:CCGGGATGAGCTTGTGTTCAAGGATCTCGAGATCCTTGAACACAAGCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014008.2-1710s21c1
Sequence:CCGGGAAGGAGCTTCAGAAGGAAATCTCGAGATTTCCTTCTGAAGCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014008.2-1032s21c1
Sequence:CCGGCTTCACGCACTCAGAGAAGTTCTCGAGAACTTCTCTGAGTGCGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014008.2-1674s21c1
Sequence:CCGGGCAGAAGGAAGAGATCACCAACTCGAGTTGGTGATCTCTTCCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014008
VALIDATED
CCDC22 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 22
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014008.1-329s1c1
Sequence:CCGGCTTGGAGCTTGGCTATCAGAACTCGAGTTCTGATAGCCAAGCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014008.1-1604s1c1
Sequence:CCGGGCAGAAGGAAGAGATCACCAACTCGAGTTGGTGATCTCTTCCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014008.1-968s1c1
Sequence:CCGGGCACTCAGAGAAGTTCACCTTCTCGAGAAGGTGAACTTCTCTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014008.1-1709s1c1
Sequence:CCGGGCTTGTGTTCAAGGATGCCAACTCGAGTTGGCATCCTTGAACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014008.1-962s1c1
Sequence:CCGGCTTCACGCACTCAGAGAAGTTCTCGAGAACTTCTCTGAGTGCGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014008.1-1650s1c1
Sequence:CCGGCAGAAGGAAATCAACTCCCTACTCGAGTAGGGAGTTGATTTCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014008.1-1622s1c1
Sequence:CCGGCAAGATCTTGTCTGATACGAACTCGAGTTCGTATCAGACAAGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014008.1-1607s1c1
Sequence:CCGGGAAGGAAGAGATCACCAAGATCTCGAGATCTTGGTGATCTCTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014008.1-1640s1c1
Sequence:CCGGGAAGGAGCTTCAGAAGGAAATCTCGAGATTTCCTTCTGAAGCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014008.1-1616s1c1
Sequence:CCGGGATCACCAAGATCTTGTCTGACTCGAGTCAGACAAGATCTTGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014008.1-1704s1c1
Sequence:CCGGGATGAGCTTGTGTTCAAGGATCTCGAGATCCTTGAACACAAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014008.1-1752s1c1
Sequence:CCGGGCCTATAAGTATCTAGCTGCTCTCGAGAGCAGCTAGATACTTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014008.1-1746s1c1
Sequence:CCGGCGGAAGGCCTATAAGTATCTACTCGAGTAGATACTTATAGGCCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014008.2-1774s21c1
Sequence:CCGGGATGAGCTTGTGTTCAAGGATCTCGAGATCCTTGAACACAAGCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014008.2-1710s21c1
Sequence:CCGGGAAGGAGCTTCAGAAGGAAATCTCGAGATTTCCTTCTGAAGCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014008.2-1032s21c1
Sequence:CCGGCTTCACGCACTCAGAGAAGTTCTCGAGAACTTCTCTGAGTGCGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014008.2-1674s21c1
Sequence:CCGGGCAGAAGGAAGAGATCACCAACTCGAGTTGGTGATCTCTTCCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138603
CCDC22 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 22
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138603.2-1049s1c1
Sequence:CCGGGCTACCTCTCAAAGGCTTGAACTCGAGTTCAAGCCTTTGAGAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138603.2-1723s1c1
Sequence:CCGGGCTTGTGTTCAAGGATGCTAACTCGAGTTAGCATCCTTGAACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138603.2-218s1c1
Sequence:CCGGCGATGCCTTCGAGTGATTAATCTCGAGATTAATCACTCGAAGGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138603.2-1618s1c1
Sequence:CCGGGCAGAAGGAAGAGATCACTAACTCGAGTTAGTGATCTCTTCCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138603.2-1124s1c1
Sequence:CCGGGCGAGTGTGAACCACAACATTCTCGAGAATGTTGTGGTTCACACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138603.2-604s1c1
Sequence:CCGGGTTGGTTCTACCTGAGTTGAACTCGAGTTCAACTCAGGTAGAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138603.2-1136s1c1
Sequence:CCGGCACAACATTGAAGAGGTTGAACTCGAGTTCAACCTCTTCAATGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138603.3-245s21c1
Sequence:CCGGCGATGCCTTCGAGTGATTAATCTCGAGATTAATCACTCGAAGGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138603.3-1076s21c1
Sequence:CCGGGCTACCTCTCAAAGGCTTGAACTCGAGTTCAAGCCTTTGAGAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138603.3-1645s21c1
Sequence:CCGGGCAGAAGGAAGAGATCACTAACTCGAGTTAGTGATCTCTTCCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138603.3-1750s21c1
Sequence:CCGGGCTTGTGTTCAAGGATGCTAACTCGAGTTAGCATCCTTGAACACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138603
CCDC22 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 22
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138603.2-1049s1c1
Sequence:CCGGGCTACCTCTCAAAGGCTTGAACTCGAGTTCAAGCCTTTGAGAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138603.2-1723s1c1
Sequence:CCGGGCTTGTGTTCAAGGATGCTAACTCGAGTTAGCATCCTTGAACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138603.2-218s1c1
Sequence:CCGGCGATGCCTTCGAGTGATTAATCTCGAGATTAATCACTCGAAGGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138603.2-1618s1c1
Sequence:CCGGGCAGAAGGAAGAGATCACTAACTCGAGTTAGTGATCTCTTCCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138603.2-1124s1c1
Sequence:CCGGGCGAGTGTGAACCACAACATTCTCGAGAATGTTGTGGTTCACACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138603.2-604s1c1
Sequence:CCGGGTTGGTTCTACCTGAGTTGAACTCGAGTTCAACTCAGGTAGAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138603.2-1136s1c1
Sequence:CCGGCACAACATTGAAGAGGTTGAACTCGAGTTCAACCTCTTCAATGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138603.3-245s21c1
Sequence:CCGGCGATGCCTTCGAGTGATTAATCTCGAGATTAATCACTCGAAGGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138603.3-1076s21c1
Sequence:CCGGGCTACCTCTCAAAGGCTTGAACTCGAGTTCAAGCCTTTGAGAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138603.3-1645s21c1
Sequence:CCGGGCAGAAGGAAGAGATCACTAACTCGAGTTAGTGATCTCTTCCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138603.3-1750s21c1
Sequence:CCGGGCTTGTGTTCAAGGATGCTAACTCGAGTTAGCATCCTTGAACACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138603
CCDC22 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 22
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138603.2-1049s1c1
Sequence:CCGGGCTACCTCTCAAAGGCTTGAACTCGAGTTCAAGCCTTTGAGAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138603.2-1723s1c1
Sequence:CCGGGCTTGTGTTCAAGGATGCTAACTCGAGTTAGCATCCTTGAACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138603.2-218s1c1
Sequence:CCGGCGATGCCTTCGAGTGATTAATCTCGAGATTAATCACTCGAAGGCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138603.2-1618s1c1
Sequence:CCGGGCAGAAGGAAGAGATCACTAACTCGAGTTAGTGATCTCTTCCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138603.2-1124s1c1
Sequence:CCGGGCGAGTGTGAACCACAACATTCTCGAGAATGTTGTGGTTCACACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198457    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138603.2-604s1c1
Sequence:CCGGGTTGGTTCTACCTGAGTTGAACTCGAGTTCAACTCAGGTAGAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138603.2-1136s1c1
Sequence:CCGGCACAACATTGAAGAGGTTGAACTCGAGTTCAACCTCTTCAATGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138603.3-245s21c1
Sequence:CCGGCGATGCCTTCGAGTGATTAATCTCGAGATTAATCACTCGAAGGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138603.3-1076s21c1
Sequence:CCGGGCTACCTCTCAAAGGCTTGAACTCGAGTTCAAGCCTTTGAGAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138603.3-1645s21c1
Sequence:CCGGGCAGAAGGAAGAGATCACTAACTCGAGTTAGTGATCTCTTCCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138603.3-1750s21c1
Sequence:CCGGGCTTGTGTTCAAGGATGCTAACTCGAGTTAGCATCCTTGAACACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks