EMAIL THIS PAGE TO A FRIEND

CCDC23

coiled-coil domain containing 23

94 Gene Product Result for
UniProtKB ID: Q8N300, A8K5P1, D3DPW7
Gene ID:
Mouse(69216) coiled-coil domain containing 23
Rat(362578) coiled-coil domain containing 23
domestic guinea pig(100725697) coiled-coil domain containing 23
naked mole-rat(101696884) coiled-coil domain containing 23
sheep(101106376) coiled-coil domain containing 23
Zebrafish(798425) Coiled-coil domain-containing protein 23
domestic cat(101094775) coiled-coil domain containing 23
cow(614073) coiled-coil domain containing 23
dog(100683368) coiled-coil domain containing 23
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA008507 Anti-SVBP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199342 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199342 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199342 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024462 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024462 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024462 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199342 Rosetta Predictions human pricing
NM_001038992 Rosetta Predictions rat pricing
NM_001038994 Rosetta Predictions rat pricing
NM_001038998 Rosetta Predictions mouse pricing
NM_024462 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114908 predicted 278
2 SASI_Hs01_00114909 predicted 251
3 SASI_Hs01_00114910 predicted 207
4 SASI_Hs01_00114911 predicted 213
5 SASI_Hs01_00114912 predicted 220
6 SASI_Hs01_00114913 predicted 217
7 SASI_Hs01_00114915 predicted 211
8 SASI_Hs02_00372779 predicted 247
9 SASI_Hs02_00372780 predicted 199
10 SASI_Hs02_00372781 predicted 206
11 SASI_Hs01_00114906 predicted 253
12 SASI_Hs01_00114907 predicted 254
13 SASI_Hs01_00114914 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038992 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204714 predicted 237
2 SASI_Rn02_00204715 predicted 282
3 SASI_Rn01_00099123 predicted 408
4 SASI_Rn01_00099124 predicted 357
5 SASI_Rn01_00099127 predicted 411
6 SASI_Rn02_00204716 predicted 239
7 SASI_Rn02_00204717 predicted 239
8 SASI_Rn02_00204718 predicted 234
9 SASI_Rn02_00204719 predicted 230
10 SASI_Rn02_00204720 predicted 231
11 SASI_Rn01_00099121 predicted 406
12 SASI_Rn01_00099122 predicted 363
13 SASI_Rn01_00099125 predicted 351
14 SASI_Rn01_00099126 predicted 346
15 SASI_Rn01_00099128 predicted 360
16 SASI_Rn01_00099129 predicted 401
17 SASI_Rn01_00099130 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038994 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058610 predicted 451
2 SASI_Rn01_00058611 predicted 456
3 SASI_Rn01_00058612 predicted 450
4 SASI_Rn01_00058613 predicted 449
5 SASI_Rn01_00058615 predicted 453
6 SASI_Rn01_00058616 predicted 501
7 SASI_Rn01_00058617 predicted 427
8 SASI_Rn01_00058618 predicted 469
9 SASI_Rn02_00204721 predicted 456
10 SASI_Rn02_00204722 predicted 442
11 SASI_Rn01_00058614 predicted 470
12 SASI_Rn01_00058619 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038998 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173027 predicted 252
2 SASI_Mm01_00173028 predicted 237
3 SASI_Mm01_00173030 predicted 325
4 SASI_Mm01_00173032 predicted 252
5 SASI_Mm01_00173033 predicted 207
6 SASI_Mm01_00173034 predicted 241
7 SASI_Mm01_00173035 predicted 191
8 SASI_Mm02_00289720 predicted 326
9 SASI_Mm02_00289721 predicted 230
10 SASI_Mm02_00289722 predicted 241
11 SASI_Mm01_00173026 predicted 271
12 SASI_Mm01_00173029 predicted 231
13 SASI_Mm01_00173031 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024462 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117551 predicted 275
2 SASI_Mm01_00117552 predicted 397
3 SASI_Mm01_00117553 predicted 351
4 SASI_Mm01_00117554 predicted 359
5 SASI_Mm01_00117555 predicted 398
6 SASI_Mm01_00117556 predicted 407
7 SASI_Mm01_00117557 predicted 233
8 SASI_Mm01_00117558 predicted 237
9 SASI_Mm01_00117559 predicted 405
10 SASI_Mm01_00117560 predicted 235
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199342
VALIDATED
CCDC23 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 23
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199342.3-455s21c1
Sequence:CCGGGATGGGATCCTGAGAGCTTTGCTCGAGCAAAGCTCTCAGGATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199342.3-518s21c1
Sequence:CCGGCCTTACAGAACTAGACCAGAACTCGAGTTCTGGTCTAGTTCTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199342.3-473s21c1
Sequence:CCGGTTGAGAGGGTGTTGCCAGTTTCTCGAGAAACTGGCAACACCCTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199342.3-590s21c1
Sequence:CCGGACTGGTTCCTCCCATCTGAATCTCGAGATTCAGATGGGAGGAACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199342.1-154s1c1
Sequence:CCGGGTTGAGAAGGCCAAACAGAAACTCGAGTTTCTGTTTGGCCTTCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_199342.1-432s1c1
Sequence:CCGGCCTGTGTGTAACTTCTAACTTCTCGAGAAGTTAGAAGTTACACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_199342.1-397s1c1
Sequence:CCGGCCAGAAGACATTTGTGGATAACTCGAGTTATCCACAAATGTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199342.1-133s1c1
Sequence:CCGGGTTAAAGAATCTGTCAGCAGACTCGAGTCTGCTGACAGATTCTTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199342.1-198s1c1
Sequence:CCGGGAGACAAAGAGCAGAGATCTACTCGAGTAGATCTCTGCTCTTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_199342.1-255s1c1
Sequence:CCGGGCAGTTTGATGAGTTCTGTAACTCGAGTTACAGAACTCATCAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_199342.1-223s1c1
Sequence:CCGGCTCAACAGAGTCATGACAGAACTCGAGTTCTGTCATGACTCTGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199342
VALIDATED
CCDC23 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 23
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199342.3-455s21c1
Sequence:CCGGGATGGGATCCTGAGAGCTTTGCTCGAGCAAAGCTCTCAGGATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199342.3-518s21c1
Sequence:CCGGCCTTACAGAACTAGACCAGAACTCGAGTTCTGGTCTAGTTCTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199342.3-473s21c1
Sequence:CCGGTTGAGAGGGTGTTGCCAGTTTCTCGAGAAACTGGCAACACCCTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199342.3-590s21c1
Sequence:CCGGACTGGTTCCTCCCATCTGAATCTCGAGATTCAGATGGGAGGAACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199342.1-154s1c1
Sequence:CCGGGTTGAGAAGGCCAAACAGAAACTCGAGTTTCTGTTTGGCCTTCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_199342.1-432s1c1
Sequence:CCGGCCTGTGTGTAACTTCTAACTTCTCGAGAAGTTAGAAGTTACACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_199342.1-397s1c1
Sequence:CCGGCCAGAAGACATTTGTGGATAACTCGAGTTATCCACAAATGTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199342.1-133s1c1
Sequence:CCGGGTTAAAGAATCTGTCAGCAGACTCGAGTCTGCTGACAGATTCTTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199342.1-198s1c1
Sequence:CCGGGAGACAAAGAGCAGAGATCTACTCGAGTAGATCTCTGCTCTTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_199342.1-255s1c1
Sequence:CCGGGCAGTTTGATGAGTTCTGTAACTCGAGTTACAGAACTCATCAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_199342.1-223s1c1
Sequence:CCGGCTCAACAGAGTCATGACAGAACTCGAGTTCTGTCATGACTCTGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199342
VALIDATED
CCDC23 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 23
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199342.3-455s21c1
Sequence:CCGGGATGGGATCCTGAGAGCTTTGCTCGAGCAAAGCTCTCAGGATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199342.3-518s21c1
Sequence:CCGGCCTTACAGAACTAGACCAGAACTCGAGTTCTGGTCTAGTTCTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424334    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199342.3-473s21c1
Sequence:CCGGTTGAGAGGGTGTTGCCAGTTTCTCGAGAAACTGGCAACACCCTCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199342.3-590s21c1
Sequence:CCGGACTGGTTCCTCCCATCTGAATCTCGAGATTCAGATGGGAGGAACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199342.1-154s1c1
Sequence:CCGGGTTGAGAAGGCCAAACAGAAACTCGAGTTTCTGTTTGGCCTTCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147475    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_199342.1-432s1c1
Sequence:CCGGCCTGTGTGTAACTTCTAACTTCTCGAGAAGTTAGAAGTTACACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_199342.1-397s1c1
Sequence:CCGGCCAGAAGACATTTGTGGATAACTCGAGTTATCCACAAATGTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199342.1-133s1c1
Sequence:CCGGGTTAAAGAATCTGTCAGCAGACTCGAGTCTGCTGACAGATTCTTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199342.1-198s1c1
Sequence:CCGGGAGACAAAGAGCAGAGATCTACTCGAGTAGATCTCTGCTCTTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_199342.1-255s1c1
Sequence:CCGGGCAGTTTGATGAGTTCTGTAACTCGAGTTACAGAACTCATCAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_199342.1-223s1c1
Sequence:CCGGCTCAACAGAGTCATGACAGAACTCGAGTTCTGTCATGACTCTGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024462
VALIDATED
CCDC23 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 23
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024462.1-227s1c1
Sequence:CCGGGACAGAGAGCAGAGATCTATGCTCGAGCATAGATCTCTGCTCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024462.1-155s1c1
Sequence:CCGGCCAAAGTTAAAGAACCAGCCTCTCGAGAGGCTGGTTCTTTAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024462.1-184s1c1
Sequence:CCGGGAGAAGGCTAAGCAGAAATCTCTCGAGAGATTTCTGCTTAGCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024462.1-214s1c1
Sequence:CCGGGAGCTGAAGCAAAGACAGAGACTCGAGTCTCTGTCTTTGCTTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024462.1-243s1c1
Sequence:CCGGCTATGCTCTCAACAGAGTCATCTCGAGATGACTCTGTTGAGAGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024462.1-156s1c1
Sequence:CCGGCAAAGTTAAAGAACCAGCCTTCTCGAGAAGGCTGGTTCTTTAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024462
VALIDATED
CCDC23 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 23
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024462.1-227s1c1
Sequence:CCGGGACAGAGAGCAGAGATCTATGCTCGAGCATAGATCTCTGCTCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024462.1-155s1c1
Sequence:CCGGCCAAAGTTAAAGAACCAGCCTCTCGAGAGGCTGGTTCTTTAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024462.1-184s1c1
Sequence:CCGGGAGAAGGCTAAGCAGAAATCTCTCGAGAGATTTCTGCTTAGCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024462.1-214s1c1
Sequence:CCGGGAGCTGAAGCAAAGACAGAGACTCGAGTCTCTGTCTTTGCTTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024462.1-243s1c1
Sequence:CCGGCTATGCTCTCAACAGAGTCATCTCGAGATGACTCTGTTGAGAGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024462.1-156s1c1
Sequence:CCGGCAAAGTTAAAGAACCAGCCTTCTCGAGAAGGCTGGTTCTTTAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024462
VALIDATED
CCDC23 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 23
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024462.1-227s1c1
Sequence:CCGGGACAGAGAGCAGAGATCTATGCTCGAGCATAGATCTCTGCTCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024462.1-155s1c1
Sequence:CCGGCCAAAGTTAAAGAACCAGCCTCTCGAGAGGCTGGTTCTTTAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024462.1-184s1c1
Sequence:CCGGGAGAAGGCTAAGCAGAAATCTCTCGAGAGATTTCTGCTTAGCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024462.1-214s1c1
Sequence:CCGGGAGCTGAAGCAAAGACAGAGACTCGAGTCTCTGTCTTTGCTTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024462.1-243s1c1
Sequence:CCGGCTATGCTCTCAACAGAGTCATCTCGAGATGACTCTGTTGAGAGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024462.1-156s1c1
Sequence:CCGGCAAAGTTAAAGAACCAGCCTTCTCGAGAAGGCTGGTTCTTTAACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks