EMAIL THIS PAGE TO A FRIEND

CCDC24

coiled-coil domain containing 24

38 Gene Product Result for
Synonyms: RP5-1198O20.2
UniProtKB ID: Q8N4L8, Q6RWT2
Gene ID:
Mouse(381546) coiled-coil domain containing 24
Rat(500534) coiled-coil domain containing 24
Zebrafish(541495) coiled-coil domain containing 24
cow(785703) coiled-coil domain-containing protein 24-like
cow(516188) coiled-coil domain containing 24
domestic cat(101099646) coiled-coil domain containing 24
sheep(101107922) coiled-coil domain containing 24
naked mole-rat(101723252) coiled-coil domain containing 24
domestic guinea pig(100724978) coiled-coil domain containing 24
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152499 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152499 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152499 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152499 Rosetta Predictions human pricing
NM_001134626 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152499 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069774 predicted 617
2 SASI_Hs01_00069775 predicted 479
3 SASI_Hs02_00366276 predicted 534
4 SASI_Hs01_00069777 predicted 1090
5 SASI_Hs02_00366277 predicted 845
6 SASI_Hs01_00069778 predicted 473
7 SASI_Hs01_00069779 predicted 685
8 SASI_Hs01_00069780 predicted 527
9 SASI_Hs01_00069781 predicted 1166
10 SASI_Hs01_00069782 predicted 602
11 SASI_Hs01_00069776 predicted 452
12 SASI_Hs01_00069783 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134626 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257739 predicted 577
2 SASI_Rn02_00257740 predicted 347
3 SASI_Rn02_00257741 predicted 564
4 SASI_Rn02_00257742 predicted 1184
5 SASI_Rn02_00257743 predicted 1027
6 SASI_Rn02_00257744 predicted 1146
7 SASI_Rn02_00257745 predicted 800
8 SASI_Rn02_00257746 predicted 582
9 SASI_Rn02_00257747 predicted 881
10 SASI_Rn02_00257748 predicted 494
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152499
CCDC24 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 24
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152499.1-630s1c1
Sequence:CCGGGAACGTGTCCAACATTGACCACTCGAGTGGTCAATGTTGGACACGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152499.1-540s1c1
Sequence:CCGGGTGTGATTTGCCAGAACAGGACTCGAGTCCTGTTCTGGCAAATCACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152499.1-235s21c1
Sequence:CCGGCGCGAAGTGAAGAGGATTCTGCTCGAGCAGAATCCTCTTCACTTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152499.1-726s21c1
Sequence:CCGGCTGCCTGGAAGAGGAGTATTTCTCGAGAAATACTCCTCTTCCAGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152499.1-483s21c1
Sequence:CCGGCCAAGCTTGGGTCCAGTATAGCTCGAGCTATACTGGACCCAAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152499.1-545s21c1
Sequence:CCGGATTTGCCAGAACAGGAGATATCTCGAGATATCTCCTGTTCTGGCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152499.1-1290s21c1
Sequence:CCGGCATCGGTCCCAAGCATCAAAGCTCGAGCTTTGATGCTTGGGACCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152499
CCDC24 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 24
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152499.1-630s1c1
Sequence:CCGGGAACGTGTCCAACATTGACCACTCGAGTGGTCAATGTTGGACACGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152499.1-540s1c1
Sequence:CCGGGTGTGATTTGCCAGAACAGGACTCGAGTCCTGTTCTGGCAAATCACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152499.1-235s21c1
Sequence:CCGGCGCGAAGTGAAGAGGATTCTGCTCGAGCAGAATCCTCTTCACTTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152499.1-726s21c1
Sequence:CCGGCTGCCTGGAAGAGGAGTATTTCTCGAGAAATACTCCTCTTCCAGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152499.1-483s21c1
Sequence:CCGGCCAAGCTTGGGTCCAGTATAGCTCGAGCTATACTGGACCCAAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152499.1-545s21c1
Sequence:CCGGATTTGCCAGAACAGGAGATATCTCGAGATATCTCCTGTTCTGGCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152499.1-1290s21c1
Sequence:CCGGCATCGGTCCCAAGCATCAAAGCTCGAGCTTTGATGCTTGGGACCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152499
CCDC24 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 24
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152499.1-630s1c1
Sequence:CCGGGAACGTGTCCAACATTGACCACTCGAGTGGTCAATGTTGGACACGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152499.1-540s1c1
Sequence:CCGGGTGTGATTTGCCAGAACAGGACTCGAGTCCTGTTCTGGCAAATCACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152499.1-235s21c1
Sequence:CCGGCGCGAAGTGAAGAGGATTCTGCTCGAGCAGAATCCTCTTCACTTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152499.1-726s21c1
Sequence:CCGGCTGCCTGGAAGAGGAGTATTTCTCGAGAAATACTCCTCTTCCAGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152499.1-483s21c1
Sequence:CCGGCCAAGCTTGGGTCCAGTATAGCTCGAGCTATACTGGACCCAAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152499.1-545s21c1
Sequence:CCGGATTTGCCAGAACAGGAGATATCTCGAGATATCTCCTGTTCTGGCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152499.1-1290s21c1
Sequence:CCGGCATCGGTCCCAAGCATCAAAGCTCGAGCTTTGATGCTTGGGACCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)