EMAIL THIS PAGE TO A FRIEND

CCDC25

coiled-coil domain containing 25

147 Gene Product Result for
UniProtKB ID: Q86WR0, Q96SI2, Q9NV98
Gene ID:
Mouse(67179) coiled-coil domain containing 25
Rat(361059) coiled-coil domain containing 25
domestic guinea pig(100712611) coiled-coil domain containing 25
naked mole-rat(101719235) coiled-coil domain containing 25
sheep(101114166) coiled-coil domain containing 25
Zebrafish(393359) coiled-coil domain containing 25
cow(507275) coiled-coil domain containing 25
domestic cat(101080530) coiled-coil domain containing 25
dog(612822) coiled-coil domain containing 25
chicken(422005) coiled-coil domain containing 25
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018246 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018246 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018246 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145944 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145944 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145944 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031708 Rosetta Predictions human pricing
NM_018246 Rosetta Predictions human pricing
NM_001108382 Rosetta Predictions rat pricing
NM_145944 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031708 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112194 predicted 382
2 SASI_Hs01_00112195 predicted 80
3 SASI_Hs01_00112196 predicted 185
4 SASI_Hs01_00112197 predicted 722
5 SASI_Hs01_00112198 predicted 194
6 SASI_Hs01_00112199 predicted 638
7 SASI_Hs01_00112200 predicted 77
8 SASI_Hs01_00112201 predicted 198
9 SASI_Hs01_00112202 predicted 179
10 SASI_Hs01_00112203 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351590 predicted 980
2 SASI_Hs01_00166143 predicted 1142
3 SASI_Hs01_00166145 predicted 1196
4 SASI_Hs01_00166142 predicted 1231
5 SASI_Hs02_00351591 predicted 1017
6 SASI_Hs02_00351592 predicted 975
7 SASI_Hs02_00351593 predicted 257
8 SASI_Hs02_00351594 predicted 261
9 SASI_Hs02_00351595 predicted 351
10 SASI_Hs02_00351596 predicted 1012
11 SASI_Hs01_00166138 predicted 1110
12 SASI_Hs01_00166139 predicted 323
13 SASI_Hs01_00166140 predicted 891
14 SASI_Hs01_00166141 predicted 734
15 SASI_Hs01_00166144 predicted 1043
16 SASI_Hs01_00166146 predicted 651
17 SASI_Hs01_00166147 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108382 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238109 predicted 1070
2 SASI_Rn02_00238110 predicted 1146
3 SASI_Rn02_00238111 predicted 251
4 SASI_Rn02_00238112 predicted 1199
5 SASI_Rn02_00238113 predicted 244
6 SASI_Rn02_00238114 predicted 1206
7 SASI_Rn02_00238115 predicted 293
8 SASI_Rn02_00238116 predicted 1114
9 SASI_Rn02_00238117 predicted 1151
10 SASI_Rn02_00238118 predicted 1027
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145944 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341399 predicted 248
2 SASI_Mm02_00341400 predicted 1208
3 SASI_Mm01_00076172 predicted 394
4 SASI_Mm01_00076176 predicted 270
5 SASI_Mm01_00076173 predicted 292
6 SASI_Mm02_00341401 predicted 1213
7 SASI_Mm02_00341402 predicted 197
8 SASI_Mm02_00341403 predicted 252
9 SASI_Mm02_00341404 predicted 294
10 SASI_Mm02_00341405 predicted 1273
11 SASI_Mm01_00076174 predicted 105
12 SASI_Mm01_00076175 predicted 685
13 SASI_Mm01_00076177 predicted 634
14 SASI_Mm01_00076178 predicted 635
15 SASI_Mm01_00076179 predicted 642
16 SASI_Mm01_00076180 predicted 461
17 SASI_Mm01_00076181 predicted 733
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018246
CCDC25 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 25
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018246.2-384s21c1
Sequence:CCGGGTATATACGCCGTGGTCTAACCTCGAGGTTAGACCACGGCGTATATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018246.2-938s21c1
Sequence:CCGGGTTGAACTTGACAGCATATAACTCGAGTTATATGCTGTCAAGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018246.2-1182s21c1
Sequence:CCGGCTGTCCCTGATTTCTCGATTACTCGAGTAATCGAGAAATCAGGGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018246.1-578s1c1
Sequence:CCGGGAAATGAAGAAGAAGAGGGAACTCGAGTTCCCTCTTCTTCTTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018246.1-659s1c1
Sequence:CCGGGATGGCAATGATTCAGATGAACTCGAGTTCATCTGAATCATTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018246.1-298s1c1
Sequence:CCGGCATTCAAGGCTGCAAGATGAACTCGAGTTCATCTTGCAGCCTTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018246.1-646s1c1
Sequence:CCGGGTCTTCAAATCAGGATGGCAACTCGAGTTGCCATCCTGATTTGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018246.1-656s1c1
Sequence:CCGGCAGGATGGCAATGATTCAGATCTCGAGATCTGAATCATTGCCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018246.1-497s1c1
Sequence:CCGGGCAGAGAAAGAATGCAGAGATCTCGAGATCTCTGCATTCTTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018246.1-306s1c1
Sequence:CCGGGCTGCAAGATGAACAACGTTACTCGAGTAACGTTGTTCATCTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018246.1-443s1c1
Sequence:CCGGGAGATCCTGAACCGATTAGAACTCGAGTTCTAATCGGTTCAGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018246
CCDC25 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 25
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018246.2-384s21c1
Sequence:CCGGGTATATACGCCGTGGTCTAACCTCGAGGTTAGACCACGGCGTATATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018246.2-938s21c1
Sequence:CCGGGTTGAACTTGACAGCATATAACTCGAGTTATATGCTGTCAAGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018246.2-1182s21c1
Sequence:CCGGCTGTCCCTGATTTCTCGATTACTCGAGTAATCGAGAAATCAGGGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018246.1-578s1c1
Sequence:CCGGGAAATGAAGAAGAAGAGGGAACTCGAGTTCCCTCTTCTTCTTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018246.1-659s1c1
Sequence:CCGGGATGGCAATGATTCAGATGAACTCGAGTTCATCTGAATCATTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018246.1-298s1c1
Sequence:CCGGCATTCAAGGCTGCAAGATGAACTCGAGTTCATCTTGCAGCCTTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018246.1-646s1c1
Sequence:CCGGGTCTTCAAATCAGGATGGCAACTCGAGTTGCCATCCTGATTTGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018246.1-656s1c1
Sequence:CCGGCAGGATGGCAATGATTCAGATCTCGAGATCTGAATCATTGCCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018246.1-497s1c1
Sequence:CCGGGCAGAGAAAGAATGCAGAGATCTCGAGATCTCTGCATTCTTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018246.1-306s1c1
Sequence:CCGGGCTGCAAGATGAACAACGTTACTCGAGTAACGTTGTTCATCTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018246.1-443s1c1
Sequence:CCGGGAGATCCTGAACCGATTAGAACTCGAGTTCTAATCGGTTCAGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018246
CCDC25 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 25
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018246.2-384s21c1
Sequence:CCGGGTATATACGCCGTGGTCTAACCTCGAGGTTAGACCACGGCGTATATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018246.2-938s21c1
Sequence:CCGGGTTGAACTTGACAGCATATAACTCGAGTTATATGCTGTCAAGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018246.2-1182s21c1
Sequence:CCGGCTGTCCCTGATTTCTCGATTACTCGAGTAATCGAGAAATCAGGGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018246.1-578s1c1
Sequence:CCGGGAAATGAAGAAGAAGAGGGAACTCGAGTTCCCTCTTCTTCTTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018246.1-659s1c1
Sequence:CCGGGATGGCAATGATTCAGATGAACTCGAGTTCATCTGAATCATTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018246.1-298s1c1
Sequence:CCGGCATTCAAGGCTGCAAGATGAACTCGAGTTCATCTTGCAGCCTTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018246.1-646s1c1
Sequence:CCGGGTCTTCAAATCAGGATGGCAACTCGAGTTGCCATCCTGATTTGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018246.1-656s1c1
Sequence:CCGGCAGGATGGCAATGATTCAGATCTCGAGATCTGAATCATTGCCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018246.1-497s1c1
Sequence:CCGGGCAGAGAAAGAATGCAGAGATCTCGAGATCTCTGCATTCTTTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018246.1-306s1c1
Sequence:CCGGGCTGCAAGATGAACAACGTTACTCGAGTAACGTTGTTCATCTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018246.1-443s1c1
Sequence:CCGGGAGATCCTGAACCGATTAGAACTCGAGTTCTAATCGGTTCAGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145944
CCDC25 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 25
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145944.4-536s21c1
Sequence:CCGGATGAAATCTTGAACCGATTAGCTCGAGCTAATCGGTTCAAGATTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145944.4-298s21c1
Sequence:CCGGGCCCATGTGTACCTACGATTACTCGAGTAATCGTAGGTACACATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145944.4-1851s21c1
Sequence:CCGGCTGGCATGCAAATCCATATTCCTCGAGGAATATGGATTTGCATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145944.4-403s21c1
Sequence:CCGGTGCAAGATGAACAACGTTAATCTCGAGATTAACGTTGTTCATCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145944.4-208s21c1
Sequence:CCGGTACATGGGAAAGGATAAATATCTCGAGATATTTATCCTTTCCCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145944
CCDC25 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 25
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145944.4-536s21c1
Sequence:CCGGATGAAATCTTGAACCGATTAGCTCGAGCTAATCGGTTCAAGATTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145944.4-298s21c1
Sequence:CCGGGCCCATGTGTACCTACGATTACTCGAGTAATCGTAGGTACACATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145944.4-1851s21c1
Sequence:CCGGCTGGCATGCAAATCCATATTCCTCGAGGAATATGGATTTGCATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145944.4-403s21c1
Sequence:CCGGTGCAAGATGAACAACGTTAATCTCGAGATTAACGTTGTTCATCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145944.4-208s21c1
Sequence:CCGGTACATGGGAAAGGATAAATATCTCGAGATATTTATCCTTTCCCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145944
CCDC25 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 25
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145944.4-536s21c1
Sequence:CCGGATGAAATCTTGAACCGATTAGCTCGAGCTAATCGGTTCAAGATTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145944.4-298s21c1
Sequence:CCGGGCCCATGTGTACCTACGATTACTCGAGTAATCGTAGGTACACATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145944.4-1851s21c1
Sequence:CCGGCTGGCATGCAAATCCATATTCCTCGAGGAATATGGATTTGCATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145944.4-403s21c1
Sequence:CCGGTGCAAGATGAACAACGTTAATCTCGAGATTAACGTTGTTCATCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145944.4-208s21c1
Sequence:CCGGTACATGGGAAAGGATAAATATCTCGAGATATTTATCCTTTCCCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks