EMAIL THIS PAGE TO A FRIEND

CCDC26

coiled-coil domain containing 26

10 Gene Product Result for
Synonyms: RAM
Species: Human CCDC26(137196)
UniProtKB ID: Q8TAB7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145050 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145050 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145050 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145050 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145050 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102175 predicted 626
2 SASI_Hs01_00102176 predicted 603
3 SASI_Hs01_00102177 predicted 625
4 SASI_Hs01_00102178 predicted 538
5 SASI_Hs01_00102179 predicted 462
6 SASI_Hs01_00102180 predicted 592
7 SASI_Hs01_00102181 predicted 585
8 SASI_Hs01_00102182 predicted 625
9 SASI_Hs01_00102183 predicted 470
10 SASI_Hs01_00102184 predicted 479
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145050
CCDC26 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 26
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145050.2-484s1c1
Sequence:CCGGGAAAGATCGAGCAGAGACAGACTCGAGTCTGTCTCTGCTCGATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162590    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145050.2-947s1c1
Sequence:CCGGCCTTAGTTTCTTTGTCTGGAACTCGAGTTCCAGACAAAGAAACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160218    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145050.2-1427s1c1
Sequence:CCGGCCAGTACTTCACAATAAGTATCTCGAGATACTTATTGTGAAGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145050.2-700s1c1
Sequence:CCGGCTGGAAATGATAGACAATATGCTCGAGCATATTGTCTATCATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145050.2-698s1c1
Sequence:CCGGCACTGGAAATGATAGACAATACTCGAGTATTGTCTATCATTTCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160799    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145050.2-901s1c1
Sequence:CCGGCCCTAATATCTGTTTGACCTTCTCGAGAAGGTCAAACAGATATTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145050.2-600s1c1
Sequence:CCGGGTATCAAAGGTTAGTGGTGAACTCGAGTTCACCACTAACCTTTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161620    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145050.2-1334s1c1
Sequence:CCGGGCTTATTGAATTGGCTAGGATCTCGAGATCCTAGCCAATTCAATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165017    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145050.2-816s1c1
Sequence:CCGGGCAGTGAGGAATCTGTGTGTTCTCGAGAACACACAGATTCCTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145050.2-730s1c1
Sequence:CCGGGAGGAGAGAAGAGAGCTGAAACTCGAGTTTCAGCTCTCTTCTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145050.2-691s1c1
Sequence:CCGGGCAGGTTCACTGGAAATGATACTCGAGTATCATTTCCAGTGAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164313    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145050.2-1412s1c1
Sequence:CCGGCCACAGAGAGAATATCCAGTACTCGAGTACTGGATATTCTCTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145050.2-491s1c1
Sequence:CCGGCGAGCAGAGACAGAGAAGAAACTCGAGTTTCTTCTCTGTCTCTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145050
CCDC26 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 26
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145050.2-484s1c1
Sequence:CCGGGAAAGATCGAGCAGAGACAGACTCGAGTCTGTCTCTGCTCGATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162590    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145050.2-947s1c1
Sequence:CCGGCCTTAGTTTCTTTGTCTGGAACTCGAGTTCCAGACAAAGAAACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160218    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145050.2-1427s1c1
Sequence:CCGGCCAGTACTTCACAATAAGTATCTCGAGATACTTATTGTGAAGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145050.2-700s1c1
Sequence:CCGGCTGGAAATGATAGACAATATGCTCGAGCATATTGTCTATCATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145050.2-698s1c1
Sequence:CCGGCACTGGAAATGATAGACAATACTCGAGTATTGTCTATCATTTCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160799    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145050.2-901s1c1
Sequence:CCGGCCCTAATATCTGTTTGACCTTCTCGAGAAGGTCAAACAGATATTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145050.2-600s1c1
Sequence:CCGGGTATCAAAGGTTAGTGGTGAACTCGAGTTCACCACTAACCTTTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161620    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145050.2-1334s1c1
Sequence:CCGGGCTTATTGAATTGGCTAGGATCTCGAGATCCTAGCCAATTCAATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165017    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145050.2-816s1c1
Sequence:CCGGGCAGTGAGGAATCTGTGTGTTCTCGAGAACACACAGATTCCTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145050.2-730s1c1
Sequence:CCGGGAGGAGAGAAGAGAGCTGAAACTCGAGTTTCAGCTCTCTTCTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145050.2-691s1c1
Sequence:CCGGGCAGGTTCACTGGAAATGATACTCGAGTATCATTTCCAGTGAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164313    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145050.2-1412s1c1
Sequence:CCGGCCACAGAGAGAATATCCAGTACTCGAGTACTGGATATTCTCTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145050.2-491s1c1
Sequence:CCGGCGAGCAGAGACAGAGAAGAAACTCGAGTTTCTTCTCTGTCTCTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145050
CCDC26 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 26
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145050.2-484s1c1
Sequence:CCGGGAAAGATCGAGCAGAGACAGACTCGAGTCTGTCTCTGCTCGATCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162590    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145050.2-947s1c1
Sequence:CCGGCCTTAGTTTCTTTGTCTGGAACTCGAGTTCCAGACAAAGAAACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160218    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145050.2-1427s1c1
Sequence:CCGGCCAGTACTTCACAATAAGTATCTCGAGATACTTATTGTGAAGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145050.2-700s1c1
Sequence:CCGGCTGGAAATGATAGACAATATGCTCGAGCATATTGTCTATCATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145050.2-698s1c1
Sequence:CCGGCACTGGAAATGATAGACAATACTCGAGTATTGTCTATCATTTCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160799    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145050.2-901s1c1
Sequence:CCGGCCCTAATATCTGTTTGACCTTCTCGAGAAGGTCAAACAGATATTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145050.2-600s1c1
Sequence:CCGGGTATCAAAGGTTAGTGGTGAACTCGAGTTCACCACTAACCTTTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161620    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145050.2-1334s1c1
Sequence:CCGGGCTTATTGAATTGGCTAGGATCTCGAGATCCTAGCCAATTCAATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165017    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145050.2-816s1c1
Sequence:CCGGGCAGTGAGGAATCTGTGTGTTCTCGAGAACACACAGATTCCTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145050.2-730s1c1
Sequence:CCGGGAGGAGAGAAGAGAGCTGAAACTCGAGTTTCAGCTCTCTTCTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145050.2-691s1c1
Sequence:CCGGGCAGGTTCACTGGAAATGATACTCGAGTATCATTTCCAGTGAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164313    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145050.2-1412s1c1
Sequence:CCGGCCACAGAGAGAATATCCAGTACTCGAGTACTGGATATTCTCTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145050.2-491s1c1
Sequence:CCGGCGAGCAGAGACAGAGAAGAAACTCGAGTTTCTTCTCTGTCTCTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks