EMAIL THIS PAGE TO A FRIEND

CCDC27

coiled-coil domain containing 27

44 Gene Product Result for
UniProtKB ID: Q2M243, Q5TBV3, Q96M50
Gene ID:
Mouse(381580) coiled-coil domain containing 27
Rat(679584) coiled-coil domain containing 27
chicken(419381) coiled-coil domain containing 27
cow(531681) coiled-coil domain containing 27
Horse(100060495) coiled-coil domain containing 27
chicken(101751184) coiled-coil domain containing 27
domestic cat(101091638) coiled-coil domain containing 27
dog(489621) coiled-coil domain containing 27
chicken(101665374) coiled-coil domain containing 27
sheep(101118718) coiled-coil domain containing 27
naked mole-rat(101711501) coiled-coil domain containing 27
domestic guinea pig(100713381) coiled-coil domain containing 27
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152492 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152492 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152492 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033455 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033455 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033455 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008691 MISSION® esiRNA esiRNA targeting human CCDC27 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152492 Rosetta Predictions human pricing
XM_001053589 Rosetta Predictions rat pricing
NM_001033455 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077269 predicted 353
2 SASI_Hs01_00077270 predicted 535
3 SASI_Hs01_00077271 predicted 945
4 SASI_Hs01_00077272 predicted 200
5 SASI_Hs01_00077273 predicted 386
6 SASI_Hs01_00077274 predicted 483
7 SASI_Hs01_00077275 predicted 1886
8 SASI_Hs01_00077276 predicted 1520
9 SASI_Hs01_00077277 predicted 758
10 SASI_Hs02_00366268 predicted 1447
11 SASI_Hs01_00077268 predicted 1935
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053589 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272880 predicted 800
2 SASI_Rn02_00272881 predicted 1416
3 SASI_Rn02_00272882 predicted 1177
4 SASI_Rn02_00272883 predicted 1148
5 SASI_Rn02_00272884 predicted 1567
6 SASI_Rn02_00272885 predicted 347
7 SASI_Rn02_00272886 predicted 533
8 SASI_Rn02_00272887 predicted 1138
9 SASI_Rn02_00272888 predicted 276
10 SASI_Rn02_00272889 predicted 1703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033455 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117974 predicted 1757
2 SASI_Mm01_00117975 predicted 1691
3 SASI_Mm02_00288792 predicted 1763
4 SASI_Mm01_00117976 predicted 1573
5 SASI_Mm01_00117977 predicted 664
6 SASI_Mm01_00117978 predicted 1362
7 SASI_Mm01_00117980 predicted 1349
8 SASI_Mm01_00117981 predicted 390
9 SASI_Mm02_00288793 predicted 1593
10 SASI_Mm01_00117983 predicted 427
11 SASI_Mm01_00117979 predicted 1567
12 SASI_Mm01_00117982 predicted 368
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152492
CCDC27 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 27
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152492.1-1891s1c1
Sequence:CCGGGCCAACGAGATCTCTGACAATCTCGAGATTGTCAGAGATCTCGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-654s1c1
Sequence:CCGGCAGTAAGAGCATCTGCGAGTTCTCGAGAACTCGCAGATGCTCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152492.1-207s1c1
Sequence:CCGGCCCATGCCTCATGTTACCTAACTCGAGTTAGGTAACATGAGGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-1400s1c1
Sequence:CCGGCAACAGGAGTGATTGCGTCTTCTCGAGAAGACGCAATCACTCCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152492.1-326s1c1
Sequence:CCGGCAGAATGGAAACCGCACCAAACTCGAGTTTGGTGCGGTTTCCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152492.1-813s1c1
Sequence:CCGGGCTGGAGATACAGGTTCAGAACTCGAGTTCTGAACCTGTATCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152492.1-1830s1c1
Sequence:CCGGCGAGAGGTTAAGGAATAAGATCTCGAGATCTTATTCCTTAACCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-1953s1c1
Sequence:CCGGCGACTACTATAATCAGCTGAACTCGAGTTCAGCTGATTATAGTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-1549s1c1
Sequence:CCGGCGAGAAGATAAGAAACACCAACTCGAGTTGGTGTTTCTTATCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-1426s1c1
Sequence:CCGGCAACAAGTGGATTTCCAAGAACTCGAGTTCTTGGAAATCCACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-1756s1c1
Sequence:CCGGCAGAGCAAGAAGGAGATGATTCTCGAGAATCATCTCCTTCTTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-1452s1c1
Sequence:CCGGGCTGCGAAAGATCAATACGGACTCGAGTCCGTATTGATCTTTCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-180s1c1
Sequence:CCGGGCAACAAAGCTCACTTGGTCTCTCGAGAGACCAAGTGAGCTTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-1941s1c1
Sequence:CCGGCTCAGAGAGAAGCGACTACTACTCGAGTAGTAGTCGCTTCTCTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152492
CCDC27 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 27
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152492.1-1891s1c1
Sequence:CCGGGCCAACGAGATCTCTGACAATCTCGAGATTGTCAGAGATCTCGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-654s1c1
Sequence:CCGGCAGTAAGAGCATCTGCGAGTTCTCGAGAACTCGCAGATGCTCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152492.1-207s1c1
Sequence:CCGGCCCATGCCTCATGTTACCTAACTCGAGTTAGGTAACATGAGGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-1400s1c1
Sequence:CCGGCAACAGGAGTGATTGCGTCTTCTCGAGAAGACGCAATCACTCCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152492.1-326s1c1
Sequence:CCGGCAGAATGGAAACCGCACCAAACTCGAGTTTGGTGCGGTTTCCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152492.1-813s1c1
Sequence:CCGGGCTGGAGATACAGGTTCAGAACTCGAGTTCTGAACCTGTATCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152492.1-1830s1c1
Sequence:CCGGCGAGAGGTTAAGGAATAAGATCTCGAGATCTTATTCCTTAACCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-1953s1c1
Sequence:CCGGCGACTACTATAATCAGCTGAACTCGAGTTCAGCTGATTATAGTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-1549s1c1
Sequence:CCGGCGAGAAGATAAGAAACACCAACTCGAGTTGGTGTTTCTTATCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-1426s1c1
Sequence:CCGGCAACAAGTGGATTTCCAAGAACTCGAGTTCTTGGAAATCCACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-1756s1c1
Sequence:CCGGCAGAGCAAGAAGGAGATGATTCTCGAGAATCATCTCCTTCTTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-1452s1c1
Sequence:CCGGGCTGCGAAAGATCAATACGGACTCGAGTCCGTATTGATCTTTCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-180s1c1
Sequence:CCGGGCAACAAAGCTCACTTGGTCTCTCGAGAGACCAAGTGAGCTTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-1941s1c1
Sequence:CCGGCTCAGAGAGAAGCGACTACTACTCGAGTAGTAGTCGCTTCTCTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152492
CCDC27 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 27
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152492.1-1891s1c1
Sequence:CCGGGCCAACGAGATCTCTGACAATCTCGAGATTGTCAGAGATCTCGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-654s1c1
Sequence:CCGGCAGTAAGAGCATCTGCGAGTTCTCGAGAACTCGCAGATGCTCTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152492.1-207s1c1
Sequence:CCGGCCCATGCCTCATGTTACCTAACTCGAGTTAGGTAACATGAGGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-1400s1c1
Sequence:CCGGCAACAGGAGTGATTGCGTCTTCTCGAGAAGACGCAATCACTCCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152492.1-326s1c1
Sequence:CCGGCAGAATGGAAACCGCACCAAACTCGAGTTTGGTGCGGTTTCCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152492.1-813s1c1
Sequence:CCGGGCTGGAGATACAGGTTCAGAACTCGAGTTCTGAACCTGTATCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152492.1-1830s1c1
Sequence:CCGGCGAGAGGTTAAGGAATAAGATCTCGAGATCTTATTCCTTAACCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-1953s1c1
Sequence:CCGGCGACTACTATAATCAGCTGAACTCGAGTTCAGCTGATTATAGTAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-1549s1c1
Sequence:CCGGCGAGAAGATAAGAAACACCAACTCGAGTTGGTGTTTCTTATCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-1426s1c1
Sequence:CCGGCAACAAGTGGATTTCCAAGAACTCGAGTTCTTGGAAATCCACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-1756s1c1
Sequence:CCGGCAGAGCAAGAAGGAGATGATTCTCGAGAATCATCTCCTTCTTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-1452s1c1
Sequence:CCGGGCTGCGAAAGATCAATACGGACTCGAGTCCGTATTGATCTTTCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-180s1c1
Sequence:CCGGGCAACAAAGCTCACTTGGTCTCTCGAGAGACCAAGTGAGCTTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152492.1-1941s1c1
Sequence:CCGGCTCAGAGAGAAGCGACTACTACTCGAGTAGTAGTCGCTTCTCTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033455
CCDC27 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 27
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033455.2-1581s21c1
Sequence:CCGGATCAGCAGTGAGCGGACTATTCTCGAGAATAGTCCGCTCACTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033455.2-1140s21c1
Sequence:CCGGACTGAGGAGGGAGAGATATTGCTCGAGCAATATCTCTCCCTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033455.2-1313s21c1
Sequence:CCGGATTCACTAGGTCCAGATATTCCTCGAGGAATATCTGGACCTAGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033455.2-383s21c1
Sequence:CCGGTCATGTGGGTTCTGCCATTATCTCGAGATAATGGCAGAACCCACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033455.2-916s21c1
Sequence:CCGGTGCAGATGCAGGAGGAATATACTCGAGTATATTCCTCCTGCATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033455
CCDC27 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 27
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033455.2-1581s21c1
Sequence:CCGGATCAGCAGTGAGCGGACTATTCTCGAGAATAGTCCGCTCACTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033455.2-1140s21c1
Sequence:CCGGACTGAGGAGGGAGAGATATTGCTCGAGCAATATCTCTCCCTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033455.2-1313s21c1
Sequence:CCGGATTCACTAGGTCCAGATATTCCTCGAGGAATATCTGGACCTAGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033455.2-383s21c1
Sequence:CCGGTCATGTGGGTTCTGCCATTATCTCGAGATAATGGCAGAACCCACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033455.2-916s21c1
Sequence:CCGGTGCAGATGCAGGAGGAATATACTCGAGTATATTCCTCCTGCATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033455
CCDC27 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 27
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033455.2-1581s21c1
Sequence:CCGGATCAGCAGTGAGCGGACTATTCTCGAGAATAGTCCGCTCACTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033455.2-1140s21c1
Sequence:CCGGACTGAGGAGGGAGAGATATTGCTCGAGCAATATCTCTCCCTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033455.2-1313s21c1
Sequence:CCGGATTCACTAGGTCCAGATATTCCTCGAGGAATATCTGGACCTAGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033455.2-383s21c1
Sequence:CCGGTCATGTGGGTTCTGCCATTATCTCGAGATAATGGCAGAACCCACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033455.2-916s21c1
Sequence:CCGGTGCAGATGCAGGAGGAATATACTCGAGTATATTCCTCCTGCATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks