EMAIL THIS PAGE TO A FRIEND

CCDC28A

coiled-coil domain containing 28A

101 Gene Product Result for
Synonyms: C6orf80 CCRL1AP
UniProtKB ID: Q8IWP9, E1P591, Q32NC7, Q66K67, Q96E23, Q9Y430
Gene ID:
Human(25901) Summary: This gene is located in a region close to the locus of the pseudogene of chemokine (C-C motif) receptor-like 1 on chromosome 6. The specific function of this gene has not yet been determined. [provided by RefSeq, Jul 2008]
Mouse(215814) coiled-coil domain containing 28A
Rat(361454) coiled-coil domain containing 28A
domestic guinea pig(100714096) coiled-coil domain containing 28A
naked mole-rat(101703118) coiled-coil domain containing 28A
sheep(101122529) coiled-coil domain containing 28A
Zebrafish(326808) coiled-coil domain containing 28A
cow(532940) coiled-coil domain containing 28A
dog(476220) coiled-coil domain containing 28A
chicken(421679) coiled-coil domain containing 28A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144820 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144820 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144820 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015439 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015439 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015439 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015439 Rosetta Predictions human pricing
NM_001037789 Rosetta Predictions rat pricing
NM_144820 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163696 predicted 1230
2 SASI_Hs01_00163698 predicted 792
3 SASI_Hs01_00163699 predicted 1239
4 SASI_Hs01_00163700 predicted 232
5 SASI_Hs01_00163701 predicted 954
6 SASI_Hs01_00163702 predicted 872
7 SASI_Hs01_00163703 predicted 982
8 SASI_Hs01_00163704 predicted 1193
9 SASI_Hs01_00163705 predicted 1068
10 SASI_Hs02_00347825 predicted 1091
11 SASI_Hs01_00163697 predicted 1081
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037789 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074656 predicted 954
2 SASI_Rn01_00074657 predicted 915
3 SASI_Rn01_00074658 predicted 887
4 SASI_Rn01_00074659 predicted 424
5 SASI_Rn01_00074661 predicted 843
6 SASI_Rn01_00074662 predicted 951
7 SASI_Rn01_00074663 predicted 771
8 SASI_Rn01_00074664 predicted 459
9 SASI_Rn01_00074665 predicted 783
10 SASI_Rn02_00204598 predicted 552
11 SASI_Rn01_00074660 predicted 736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144820 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340190 predicted 923
2 SASI_Mm02_00340191 predicted 538
3 SASI_Mm02_00340192 predicted 932
4 SASI_Mm01_00166354 predicted 619
5 SASI_Mm02_00340193 predicted 937
6 SASI_Mm01_00166353 predicted 545
7 SASI_Mm02_00340194 predicted 538
8 SASI_Mm01_00166359 predicted 484
9 SASI_Mm02_00340195 predicted 832
10 SASI_Mm02_00340196 predicted 644
11 SASI_Mm01_00166351 predicted 1077
12 SASI_Mm01_00166352 predicted 454
13 SASI_Mm01_00166355 predicted 953
14 SASI_Mm01_00166356 predicted 1011
15 SASI_Mm01_00166357 predicted 554
16 SASI_Mm01_00166358 predicted 800
17 SASI_Mm01_00166360 predicted 1036
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144820
VALIDATED
CCDC28A MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 28A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144820.3-947s21c1
Sequence:CCGGTTGAAATGCTTTGTGCTAAACCTCGAGGTTTAGCACAAAGCATTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144820.3-633s21c1
Sequence:CCGGACAGGCTTCTGTCGGACTTAGCTCGAGCTAAGTCCGACAGAAGCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144820.3-709s21c1
Sequence:CCGGCAATGCGTCCAGCAGCTAAAGCTCGAGCTTTAGCTGCTGGACGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144820.3-483s21c1
Sequence:CCGGTGCAGGCGTTTGGAAATGAATCTCGAGATTCATTTCCAAACGCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144820.1-458s1c1
Sequence:CCGGGAACGATTTCCACTCTGGAAACTCGAGTTTCCAGAGTGGAAATCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144820.1-694s1c1
Sequence:CCGGCAGAAGACCCAGATTCTGTTTCTCGAGAAACAGAATCTGGGTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144820.1-688s1c1
Sequence:CCGGCTCTTGCAGAAGACCCAGATTCTCGAGAATCTGGGTCTTCTGCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144820.1-578s1c1
Sequence:CCGGGTTAGAGGAACTTCCTGAGGACTCGAGTCCTCAGGAAGTTCCTCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144820
VALIDATED
CCDC28A MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 28A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144820.3-947s21c1
Sequence:CCGGTTGAAATGCTTTGTGCTAAACCTCGAGGTTTAGCACAAAGCATTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144820.3-633s21c1
Sequence:CCGGACAGGCTTCTGTCGGACTTAGCTCGAGCTAAGTCCGACAGAAGCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144820.3-709s21c1
Sequence:CCGGCAATGCGTCCAGCAGCTAAAGCTCGAGCTTTAGCTGCTGGACGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144820.3-483s21c1
Sequence:CCGGTGCAGGCGTTTGGAAATGAATCTCGAGATTCATTTCCAAACGCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144820.1-458s1c1
Sequence:CCGGGAACGATTTCCACTCTGGAAACTCGAGTTTCCAGAGTGGAAATCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144820.1-694s1c1
Sequence:CCGGCAGAAGACCCAGATTCTGTTTCTCGAGAAACAGAATCTGGGTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144820.1-688s1c1
Sequence:CCGGCTCTTGCAGAAGACCCAGATTCTCGAGAATCTGGGTCTTCTGCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144820.1-578s1c1
Sequence:CCGGGTTAGAGGAACTTCCTGAGGACTCGAGTCCTCAGGAAGTTCCTCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144820
VALIDATED
CCDC28A MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 28A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144820.3-947s21c1
Sequence:CCGGTTGAAATGCTTTGTGCTAAACCTCGAGGTTTAGCACAAAGCATTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144820.3-633s21c1
Sequence:CCGGACAGGCTTCTGTCGGACTTAGCTCGAGCTAAGTCCGACAGAAGCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144820.3-709s21c1
Sequence:CCGGCAATGCGTCCAGCAGCTAAAGCTCGAGCTTTAGCTGCTGGACGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144820.3-483s21c1
Sequence:CCGGTGCAGGCGTTTGGAAATGAATCTCGAGATTCATTTCCAAACGCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144820.1-458s1c1
Sequence:CCGGGAACGATTTCCACTCTGGAAACTCGAGTTTCCAGAGTGGAAATCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144820.1-694s1c1
Sequence:CCGGCAGAAGACCCAGATTCTGTTTCTCGAGAAACAGAATCTGGGTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144820.1-688s1c1
Sequence:CCGGCTCTTGCAGAAGACCCAGATTCTCGAGAATCTGGGTCTTCTGCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144820.1-578s1c1
Sequence:CCGGGTTAGAGGAACTTCCTGAGGACTCGAGTCCTCAGGAAGTTCCTCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015439
VALIDATED
CCDC28A MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 28A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000303593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015439.2-885s21c1
Sequence:CCGGGATAGGCTTCTGTCAGATTTACTCGAGTAAATCTGACAGAAGCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015439.2-791s21c1
Sequence:CCGGGCAGGAGAAATTAGCTCGCTTCTCGAGAAGCGAGCTAATTTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015439.2-735s21c1
Sequence:CCGGCTTCAAGCATTTGGAAATGAACTCGAGTTCATTTCCAAATGCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015439.2-371s21c1
Sequence:CCGGCCTTCTTCTTCAGGTCTTAAGCTCGAGCTTAAGACCTGAAGAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015439.2-1130s21c1
Sequence:CCGGGTAAATGTGACTCGCTGTAATCTCGAGATTACAGCGAGTCACATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015439.2-807s1c1
Sequence:CCGGCGCTTGAATTTGGAGCTCTATCTCGAGATAGAGCTCCAAATTCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015439.2-227s1c1
Sequence:CCGGGCTGTACCTCTTACGTCACTTCTCGAGAAGTGACGTAAGAGGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015439.2-791s1c1
Sequence:CCGGGCAGGAGAAATTAGCTCGCTTCTCGAGAAGCGAGCTAATTTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015439.2-400s1c1
Sequence:CCGGCGTGGTGCAATAAGGAACTTACTCGAGTAAGTTCCTTATTGCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015439.2-735s1c1
Sequence:CCGGCTTCAAGCATTTGGAAATGAACTCGAGTTCATTTCCAAATGCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015439
VALIDATED
CCDC28A MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 28A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000303593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015439.2-885s21c1
Sequence:CCGGGATAGGCTTCTGTCAGATTTACTCGAGTAAATCTGACAGAAGCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015439.2-791s21c1
Sequence:CCGGGCAGGAGAAATTAGCTCGCTTCTCGAGAAGCGAGCTAATTTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015439.2-735s21c1
Sequence:CCGGCTTCAAGCATTTGGAAATGAACTCGAGTTCATTTCCAAATGCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015439.2-371s21c1
Sequence:CCGGCCTTCTTCTTCAGGTCTTAAGCTCGAGCTTAAGACCTGAAGAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015439.2-1130s21c1
Sequence:CCGGGTAAATGTGACTCGCTGTAATCTCGAGATTACAGCGAGTCACATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015439.2-807s1c1
Sequence:CCGGCGCTTGAATTTGGAGCTCTATCTCGAGATAGAGCTCCAAATTCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015439.2-227s1c1
Sequence:CCGGGCTGTACCTCTTACGTCACTTCTCGAGAAGTGACGTAAGAGGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015439.2-791s1c1
Sequence:CCGGGCAGGAGAAATTAGCTCGCTTCTCGAGAAGCGAGCTAATTTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015439.2-400s1c1
Sequence:CCGGCGTGGTGCAATAAGGAACTTACTCGAGTAAGTTCCTTATTGCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015439.2-735s1c1
Sequence:CCGGCTTCAAGCATTTGGAAATGAACTCGAGTTCATTTCCAAATGCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015439
VALIDATED
CCDC28A MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 28A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000303593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015439.2-885s21c1
Sequence:CCGGGATAGGCTTCTGTCAGATTTACTCGAGTAAATCTGACAGAAGCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015439.2-791s21c1
Sequence:CCGGGCAGGAGAAATTAGCTCGCTTCTCGAGAAGCGAGCTAATTTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015439.2-735s21c1
Sequence:CCGGCTTCAAGCATTTGGAAATGAACTCGAGTTCATTTCCAAATGCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015439.2-371s21c1
Sequence:CCGGCCTTCTTCTTCAGGTCTTAAGCTCGAGCTTAAGACCTGAAGAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015439.2-1130s21c1
Sequence:CCGGGTAAATGTGACTCGCTGTAATCTCGAGATTACAGCGAGTCACATTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015439.2-807s1c1
Sequence:CCGGCGCTTGAATTTGGAGCTCTATCTCGAGATAGAGCTCCAAATTCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015439.2-227s1c1
Sequence:CCGGGCTGTACCTCTTACGTCACTTCTCGAGAAGTGACGTAAGAGGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015439.2-791s1c1
Sequence:CCGGGCAGGAGAAATTAGCTCGCTTCTCGAGAAGCGAGCTAATTTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015439.2-400s1c1
Sequence:CCGGCGTGGTGCAATAAGGAACTTACTCGAGTAAGTTCCTTATTGCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015439.2-735s1c1
Sequence:CCGGCTTCAAGCATTTGGAAATGAACTCGAGTTCATTTCCAAATGCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks