EMAIL THIS PAGE TO A FRIEND

CCDC28B

coiled-coil domain containing 28B

57 Gene Product Result for
Synonyms: RP4-622L5.5
UniProtKB ID: Q9BUN5, A8K789, Q8TBV8
Gene ID:
Human(79140) Summary: The product of this gene localizes to centrosomes and basal bodies. It interacts and colocalizes with several proteins associated with Bardet-Biedl syndrome (BBS). [provided by RefSeq, Jul 2008]
Mouse(66264) coiled coil domain containing 28B
Rat(682445) coiled coil domain containing 28B
Zebrafish(559814) coiled-coil domain containing 28B
dog(487312) coiled-coil domain containing 28B
cow(507607) coiled-coil domain containing 28B
domestic cat(101098068) coiled-coil domain containing 28B
chicken(419647) coiled-coil domain containing 28B
sheep(101105986) coiled-coil domain containing 28B
naked mole-rat(101713829) coiled-coil domain containing 28B
domestic guinea pig(100721337) coiled-coil domain containing 28B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025455 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025455 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025455 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024296 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024296 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024296 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024296 Rosetta Predictions human pricing
NM_001134689 Rosetta Predictions rat pricing
NM_025455 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024296 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356628 predicted 233
2 SASI_Hs02_00356629 predicted 382
3 SASI_Hs02_00356630 predicted 614
4 SASI_Hs02_00356631 predicted 377
5 SASI_Hs02_00356632 predicted 644
6 SASI_Hs02_00356633 predicted 600
7 SASI_Hs02_00356634 predicted 233
8 SASI_Hs02_00356635 predicted 462
9 SASI_Hs02_00356636 predicted 286
10 SASI_Hs02_00356637 predicted 656
11 SASI_Hs01_00247191 predicted 1141
12 SASI_Hs01_00247192 predicted 919
13 SASI_Hs01_00247193 predicted 796
14 SASI_Hs01_00247194 predicted 788
15 SASI_Hs01_00247195 predicted 625
16 SASI_Hs01_00247196 predicted 1129
17 SASI_Hs01_00247197 predicted 905
18 SASI_Hs01_00247198 predicted 679
19 SASI_Hs01_00247199 predicted 784
20 SASI_Hs01_00247200 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134689 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257939 predicted 460
2 SASI_Rn02_00257940 predicted 355
3 SASI_Rn02_00257941 predicted 218
4 SASI_Rn02_00257942 predicted 352
5 SASI_Rn02_00257943 predicted 457
6 SASI_Rn02_00257944 predicted 353
7 SASI_Rn02_00257945 predicted 405
8 SASI_Rn02_00257946 predicted 298
9 SASI_Rn02_00257947 predicted 391
10 SASI_Rn02_00257948 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025455 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093552 predicted 365
2 SASI_Mm01_00093553 predicted 404
3 SASI_Mm01_00093554 predicted 361
4 SASI_Mm01_00093555 predicted 402
5 SASI_Mm01_00093556 predicted 365
6 SASI_Mm01_00093557 predicted 257
7 SASI_Mm01_00093558 predicted 604
8 SASI_Mm01_00093559 predicted 446
9 SASI_Mm01_00093560 predicted 444
10 SASI_Mm01_00093561 predicted 435
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025455
CCDC28B MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 28B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025455.1-370s1c1
Sequence:CCGGGATGTTTATGAGATGGAGGGACTCGAGTCCCTCCATCTCATAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025455.1-396s1c1
Sequence:CCGGGCTGAACTTGCTCAATGATTTCTCGAGAAATCATTGAGCAAGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025455.1-651s1c1
Sequence:CCGGCAATTCCATACAGAAGCTACACTCGAGTGTAGCTTCTGTATGGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025455.1-627s1c1
Sequence:CCGGGCTTAGCAATCTGGAAGATCTCTCGAGAGATCTTCCAGATTGCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025455.1-628s1c1
Sequence:CCGGCTTAGCAATCTGGAAGATCTTCTCGAGAAGATCTTCCAGATTGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025455.1-394s1c1
Sequence:CCGGCTGCTGAACTTGCTCAATGATCTCGAGATCATTGAGCAAGTTCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025455.2-367s1c1
Sequence:CCGGCAGAGGTGACAGATGTTTATGCTCGAGCATAAACATCTGTCACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025455
CCDC28B MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 28B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025455.1-370s1c1
Sequence:CCGGGATGTTTATGAGATGGAGGGACTCGAGTCCCTCCATCTCATAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025455.1-396s1c1
Sequence:CCGGGCTGAACTTGCTCAATGATTTCTCGAGAAATCATTGAGCAAGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025455.1-651s1c1
Sequence:CCGGCAATTCCATACAGAAGCTACACTCGAGTGTAGCTTCTGTATGGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025455.1-627s1c1
Sequence:CCGGGCTTAGCAATCTGGAAGATCTCTCGAGAGATCTTCCAGATTGCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025455.1-628s1c1
Sequence:CCGGCTTAGCAATCTGGAAGATCTTCTCGAGAAGATCTTCCAGATTGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025455.1-394s1c1
Sequence:CCGGCTGCTGAACTTGCTCAATGATCTCGAGATCATTGAGCAAGTTCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025455.2-367s1c1
Sequence:CCGGCAGAGGTGACAGATGTTTATGCTCGAGCATAAACATCTGTCACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025455
CCDC28B MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 28B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025455.1-370s1c1
Sequence:CCGGGATGTTTATGAGATGGAGGGACTCGAGTCCCTCCATCTCATAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025455.1-396s1c1
Sequence:CCGGGCTGAACTTGCTCAATGATTTCTCGAGAAATCATTGAGCAAGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025455.1-651s1c1
Sequence:CCGGCAATTCCATACAGAAGCTACACTCGAGTGTAGCTTCTGTATGGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025455.1-627s1c1
Sequence:CCGGGCTTAGCAATCTGGAAGATCTCTCGAGAGATCTTCCAGATTGCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025455.1-628s1c1
Sequence:CCGGCTTAGCAATCTGGAAGATCTTCTCGAGAAGATCTTCCAGATTGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025455.1-394s1c1
Sequence:CCGGCTGCTGAACTTGCTCAATGATCTCGAGATCATTGAGCAAGTTCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025455.2-367s1c1
Sequence:CCGGCAGAGGTGACAGATGTTTATGCTCGAGCATAAACATCTGTCACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024296
CCDC28B MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 28B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024296.2-751s1c1
Sequence:CCGGCTCTTGCAGTCCTGTCAGATTCTCGAGAATCTGACAGGACTGCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024296.2-616s1c1
Sequence:CCGGGCTTAGCAATCTGGAAGACCTCTCGAGAGGTCTTCCAGATTGCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172581    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024296.2-917s1c1
Sequence:CCGGGTCCTCCTATCCTTTCAGCATCTCGAGATGCTGAAAGGATAGGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024296.2-621s1c1
Sequence:CCGGGCAATCTGGAAGACCTCAGTACTCGAGTACTGAGGTCTTCCAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024296.2-577s1c1
Sequence:CCGGGCAGAAGAAGACAATGGCTGACTCGAGTCAGCCATTGTCTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024296.2-668s1c1
Sequence:CCGGCGTCTATGTGTGTGTGTTCCTCTCGAGAGGAACACACACACATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168074    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024296.2-791s1c1
Sequence:CCGGCCCAGGTACAGGAATTTAGAACTCGAGTTCTAAATTCCTGTACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024296.2-253s1c1
Sequence:CCGGCAAGTTCAAGAGAGTAGGCAACTCGAGTTGCCTACTCTCTTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024296.2-385s1c1
Sequence:CCGGCCTGAACCTGCTCAATGATTTCTCGAGAAATCATTGAGCAGGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167156    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024296.2-927s1c1
Sequence:CCGGCCTTTCAGCATTGAACAATTACTCGAGTAATTGTTCAATGCTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024296.2-632s1c1
Sequence:CCGGGACCTCAGTAATTCTATGTATCTCGAGATACATAGAATTACTGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024296
CCDC28B MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 28B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024296.2-751s1c1
Sequence:CCGGCTCTTGCAGTCCTGTCAGATTCTCGAGAATCTGACAGGACTGCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024296.2-616s1c1
Sequence:CCGGGCTTAGCAATCTGGAAGACCTCTCGAGAGGTCTTCCAGATTGCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172581    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024296.2-917s1c1
Sequence:CCGGGTCCTCCTATCCTTTCAGCATCTCGAGATGCTGAAAGGATAGGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024296.2-621s1c1
Sequence:CCGGGCAATCTGGAAGACCTCAGTACTCGAGTACTGAGGTCTTCCAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024296.2-577s1c1
Sequence:CCGGGCAGAAGAAGACAATGGCTGACTCGAGTCAGCCATTGTCTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024296.2-668s1c1
Sequence:CCGGCGTCTATGTGTGTGTGTTCCTCTCGAGAGGAACACACACACATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168074    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024296.2-791s1c1
Sequence:CCGGCCCAGGTACAGGAATTTAGAACTCGAGTTCTAAATTCCTGTACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024296.2-253s1c1
Sequence:CCGGCAAGTTCAAGAGAGTAGGCAACTCGAGTTGCCTACTCTCTTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024296.2-385s1c1
Sequence:CCGGCCTGAACCTGCTCAATGATTTCTCGAGAAATCATTGAGCAGGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167156    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024296.2-927s1c1
Sequence:CCGGCCTTTCAGCATTGAACAATTACTCGAGTAATTGTTCAATGCTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024296.2-632s1c1
Sequence:CCGGGACCTCAGTAATTCTATGTATCTCGAGATACATAGAATTACTGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024296
CCDC28B MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 28B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024296.2-751s1c1
Sequence:CCGGCTCTTGCAGTCCTGTCAGATTCTCGAGAATCTGACAGGACTGCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024296.2-616s1c1
Sequence:CCGGGCTTAGCAATCTGGAAGACCTCTCGAGAGGTCTTCCAGATTGCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172581    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024296.2-917s1c1
Sequence:CCGGGTCCTCCTATCCTTTCAGCATCTCGAGATGCTGAAAGGATAGGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024296.2-621s1c1
Sequence:CCGGGCAATCTGGAAGACCTCAGTACTCGAGTACTGAGGTCTTCCAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024296.2-577s1c1
Sequence:CCGGGCAGAAGAAGACAATGGCTGACTCGAGTCAGCCATTGTCTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024296.2-668s1c1
Sequence:CCGGCGTCTATGTGTGTGTGTTCCTCTCGAGAGGAACACACACACATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168074    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024296.2-791s1c1
Sequence:CCGGCCCAGGTACAGGAATTTAGAACTCGAGTTCTAAATTCCTGTACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024296.2-253s1c1
Sequence:CCGGCAAGTTCAAGAGAGTAGGCAACTCGAGTTGCCTACTCTCTTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024296.2-385s1c1
Sequence:CCGGCCTGAACCTGCTCAATGATTTCTCGAGAAATCATTGAGCAGGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167156    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024296.2-927s1c1
Sequence:CCGGCCTTTCAGCATTGAACAATTACTCGAGTAATTGTTCAATGCTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024296.2-632s1c1
Sequence:CCGGGACCTCAGTAATTCTATGTATCTCGAGATACATAGAATTACTGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks