EMAIL THIS PAGE TO A FRIEND

CCDC30

coiled-coil domain containing 30

111 Gene Product Result for
Synonyms: PFD6L PFDN6L
UniProtKB ID: Q5VVM6, Q14F06, Q5VVM5
Gene ID:
Mouse(73332) coiled-coil domain containing 30
Rat(362580) coiled-coil domain containing 30
chicken(419508) coiled-coil domain containing 30
cow(100297243) coiled-coil domain containing 30
cow(100336325) coiled-coil domain containing 30
domestic cat(101099645) coiled-coil domain containing 30
dog(475308) coiled-coil domain containing 30
sheep(101102114) coiled-coil domain containing 30
domestic guinea pig(100725430) coiled-coil domain containing 30
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029286 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029286 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029286 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080850 Rosetta Predictions human pricing
XM_001073839 Rosetta Predictions rat pricing
XM_342899 Rosetta Predictions rat pricing
NM_029286 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316137 predicted 448
2 SASI_Hs02_00316138 predicted 1559
3 SASI_Hs02_00316139 predicted 683
4 SASI_Hs02_00316140 predicted 911
5 SASI_Hs02_00316141 predicted 821
6 SASI_Hs02_00316142 predicted 1651
7 SASI_Hs02_00316143 predicted 1443
8 SASI_Hs02_00316144 predicted 1673
9 SASI_Hs02_00316145 predicted 575
10 SASI_Hs02_00316146 predicted 2534
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073839 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00344137 predicted 768
2 SASI_Rn02_00344138 predicted 1251
3 SASI_Rn02_00344139 predicted 1323
4 SASI_Rn02_00344140 predicted 1422
5 SASI_Rn02_00344141 predicted 1879
6 SASI_Rn02_00344142 predicted 1890
7 SASI_Rn02_00344143 predicted 1172
8 SASI_Rn02_00344144 predicted 1562
9 SASI_Rn02_00344145 predicted 1539
10 SASI_Rn02_00344146 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342899 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394981 predicted 328
2 SASI_Rn02_00394982 predicted 362
3 SASI_Rn02_00394983 predicted 656
4 SASI_Rn02_00394984 predicted 436
5 SASI_Rn02_00394985 predicted 665
6 SASI_Rn02_00394986 predicted 669
7 SASI_Rn02_00394987 predicted 291
8 SASI_Rn02_00394988 predicted 245
9 SASI_Rn02_00394989 predicted 533
10 SASI_Rn02_00394990 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029286 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335086 predicted 1551
2 SASI_Mm02_00335087 predicted 769
3 SASI_Mm02_00335088 predicted 1699
4 SASI_Mm02_00335089 predicted 781
5 SASI_Mm02_00335090 predicted 2278
6 SASI_Mm02_00335091 predicted 1766
7 SASI_Mm02_00335092 predicted 1944
8 SASI_Mm02_00335093 predicted 2118
9 SASI_Mm02_00335094 predicted 2131
10 SASI_Mm02_00335095 predicted 2287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029286
CCDC30 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 30
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029286.1-2296s21c1
Sequence:CCGGGGATTCAGAAAGTGGATATATCTCGAGATATATCCACTTTCTGAATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029286.1-1628s21c1
Sequence:CCGGTTGTCAGAGAAACTATCTAACCTCGAGGTTAGATAGTTTCTCTGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029286.1-1796s21c1
Sequence:CCGGATACGGAATAAGAGGATTAAACTCGAGTTTAATCCTCTTATTCCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029286.1-1988s21c1
Sequence:CCGGTTCCAGAGCAAGGCGTCTTTACTCGAGTAAAGACGCCTTGCTCTGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029286.1-2123s21c1
Sequence:CCGGATTACTGACAACGCTGCATTTCTCGAGAAATGCAGCGTTGTCAGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029286
CCDC30 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 30
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029286.1-2296s21c1
Sequence:CCGGGGATTCAGAAAGTGGATATATCTCGAGATATATCCACTTTCTGAATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029286.1-1628s21c1
Sequence:CCGGTTGTCAGAGAAACTATCTAACCTCGAGGTTAGATAGTTTCTCTGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029286.1-1796s21c1
Sequence:CCGGATACGGAATAAGAGGATTAAACTCGAGTTTAATCCTCTTATTCCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029286.1-1988s21c1
Sequence:CCGGTTCCAGAGCAAGGCGTCTTTACTCGAGTAAAGACGCCTTGCTCTGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029286.1-2123s21c1
Sequence:CCGGATTACTGACAACGCTGCATTTCTCGAGAAATGCAGCGTTGTCAGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029286
CCDC30 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 30
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029286.1-2296s21c1
Sequence:CCGGGGATTCAGAAAGTGGATATATCTCGAGATATATCCACTTTCTGAATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029286.1-1628s21c1
Sequence:CCGGTTGTCAGAGAAACTATCTAACCTCGAGGTTAGATAGTTTCTCTGACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029286.1-1796s21c1
Sequence:CCGGATACGGAATAAGAGGATTAAACTCGAGTTTAATCCTCTTATTCCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029286.1-1988s21c1
Sequence:CCGGTTCCAGAGCAAGGCGTCTTTACTCGAGTAAAGACGCCTTGCTCTGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029286.1-2123s21c1
Sequence:CCGGATTACTGACAACGCTGCATTTCTCGAGAAATGCAGCGTTGTCAGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)