EMAIL THIS PAGE TO A FRIEND

CCDC33

coiled-coil domain containing 33

71 Gene Product Result for
Synonyms: CT61
Gene ID:
Mouse(382077) coiled-coil domain containing 33
Rat(315712) coiled-coil domain containing 33
sheep(101120277) coiled-coil domain containing 33
naked mole-rat(101706159) coiled-coil domain containing 33
Zebrafish(553442) coiled-coil domain containing 33
cow(788320) coiled-coil domain containing 33
domestic cat(101086233) coiled-coil domain containing 33
Horse(100062599) coiled-coil domain containing 33
dog(478364) coiled-coil domain containing 33
chicken(101751808) coiled-coil domain containing 33
chicken(101666426) coiled-coil domain containing 33
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304389 ANTI-CCD33 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182791 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182791 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182791 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029212 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029212 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029212 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU081761 MISSION® esiRNA esiRNA human CCDC33 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025055 Rosetta Predictions human pricing
NM_182791 Rosetta Predictions human pricing
NM_001014091 Rosetta Predictions rat pricing
NM_029212 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357705 predicted 1253
2 SASI_Hs02_00357706 predicted 1916
3 SASI_Hs02_00357707 predicted 2202
4 SASI_Hs02_00357708 predicted 1833
5 SASI_Hs02_00357709 predicted 491
6 SASI_Hs02_00357710 predicted 1331
7 SASI_Hs02_00357711 predicted 902
8 SASI_Hs02_00357712 predicted 2341
9 SASI_Hs02_00357713 predicted 1314
10 SASI_Hs02_00357714 predicted 1347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182791 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060334 predicted 1444
2 SASI_Hs01_00060335 predicted 628
3 SASI_Hs01_00060336 predicted 569
4 SASI_Hs01_00060337 predicted 1414
5 SASI_Hs01_00060338 predicted 250
6 SASI_Hs01_00060339 predicted 827
7 SASI_Hs01_00060340 predicted 329
8 SASI_Hs02_00370941 predicted 844
9 SASI_Hs01_00060341 predicted 288
10 SASI_Hs01_00060342 predicted 1412
11 SASI_Hs01_00060343 predicted 1422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014091 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053684 predicted 2733
2 SASI_Rn01_00053685 predicted 1284
3 SASI_Rn01_00053686 predicted 2074
4 SASI_Rn02_00201521 predicted 1235
5 SASI_Rn01_00053688 predicted 856
6 SASI_Rn01_00053689 predicted 2468
7 SASI_Rn02_00201522 predicted 398
8 SASI_Rn01_00053690 predicted 1499
9 SASI_Rn01_00053692 predicted 423
10 SASI_Rn02_00201523 predicted 902
11 SASI_Rn01_00053683 predicted 817
12 SASI_Rn01_00053687 predicted 582
13 SASI_Rn01_00053691 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029212 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069198 predicted 686
2 SASI_Mm01_00069199 predicted 1575
3 SASI_Mm01_00069200 predicted 1236
4 SASI_Mm02_00335001 predicted 340
5 SASI_Mm01_00069202 predicted 1217
6 SASI_Mm01_00069203 predicted 1693
7 SASI_Mm01_00069204 predicted 877
8 SASI_Mm01_00069205 predicted 954
9 SASI_Mm01_00069206 predicted 972
10 SASI_Mm02_00335002 predicted 1583
11 SASI_Mm01_00069201 predicted 551
12 SASI_Mm01_00069207 predicted 2118
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182791
VALIDATED
CCDC33 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 33
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182791.1-278s1c1
Sequence:CCGGGCTGAGTGAGCTGGATATGAACTCGAGTTCATATCCAGCTCACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182791.1-916s1c1
Sequence:CCGGGAAAGCCAGTTAGAGGACTCACTCGAGTGAGTCCTCTAACTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182791.1-320s1c1
Sequence:CCGGGCATTTGCAGAATGAGCTGATCTCGAGATCAGCTCATTCTGCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182791.2-288s21c1
Sequence:CCGGTGCTGAGTGAGCTGGATATGACTCGAGTCATATCCAGCTCACTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182791.2-631s21c1
Sequence:CCGGGAACCTGCCGGTTGAACTTTACTCGAGTAAAGTTCAACCGGCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182791.2-352s21c1
Sequence:CCGGTCGAAAGAATGATCGAGAGAACTCGAGTTCTCTCGATCATTCTTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_182791.2-1210s21c1
Sequence:CCGGCCGAAGGCTCGGTCTTAATTCCTCGAGGAATTAAGACCGAGCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_182791.2-1023s21c1
Sequence:CCGGCCTCGAACTCCATCATCATAGCTCGAGCTATGATGATGGAGTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182791
VALIDATED
CCDC33 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 33
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182791.1-278s1c1
Sequence:CCGGGCTGAGTGAGCTGGATATGAACTCGAGTTCATATCCAGCTCACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182791.1-916s1c1
Sequence:CCGGGAAAGCCAGTTAGAGGACTCACTCGAGTGAGTCCTCTAACTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182791.1-320s1c1
Sequence:CCGGGCATTTGCAGAATGAGCTGATCTCGAGATCAGCTCATTCTGCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182791.2-288s21c1
Sequence:CCGGTGCTGAGTGAGCTGGATATGACTCGAGTCATATCCAGCTCACTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182791.2-631s21c1
Sequence:CCGGGAACCTGCCGGTTGAACTTTACTCGAGTAAAGTTCAACCGGCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182791.2-352s21c1
Sequence:CCGGTCGAAAGAATGATCGAGAGAACTCGAGTTCTCTCGATCATTCTTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_182791.2-1210s21c1
Sequence:CCGGCCGAAGGCTCGGTCTTAATTCCTCGAGGAATTAAGACCGAGCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_182791.2-1023s21c1
Sequence:CCGGCCTCGAACTCCATCATCATAGCTCGAGCTATGATGATGGAGTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182791
VALIDATED
CCDC33 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 33
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182791.1-278s1c1
Sequence:CCGGGCTGAGTGAGCTGGATATGAACTCGAGTTCATATCCAGCTCACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182791.1-916s1c1
Sequence:CCGGGAAAGCCAGTTAGAGGACTCACTCGAGTGAGTCCTCTAACTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182791.1-320s1c1
Sequence:CCGGGCATTTGCAGAATGAGCTGATCTCGAGATCAGCTCATTCTGCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182791.2-288s21c1
Sequence:CCGGTGCTGAGTGAGCTGGATATGACTCGAGTCATATCCAGCTCACTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182791.2-631s21c1
Sequence:CCGGGAACCTGCCGGTTGAACTTTACTCGAGTAAAGTTCAACCGGCAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182791.2-352s21c1
Sequence:CCGGTCGAAAGAATGATCGAGAGAACTCGAGTTCTCTCGATCATTCTTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_182791.2-1210s21c1
Sequence:CCGGCCGAAGGCTCGGTCTTAATTCCTCGAGGAATTAAGACCGAGCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_182791.2-1023s21c1
Sequence:CCGGCCTCGAACTCCATCATCATAGCTCGAGCTATGATGATGGAGTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029212
CCDC33 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 33
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029212.1-1060s1c1
Sequence:CCGGCCAATGAACTTTGATGTGCCTCTCGAGAGGCACATCAAAGTTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029212.1-445s1c1
Sequence:CCGGGCTCCCTGTAATAAGGAGACTCTCGAGAGTCTCCTTATTACAGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029212.3-682s21c1
Sequence:CCGGCTTCCACCCATACCAATTTAACTCGAGTTAAATTGGTATGGGTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029212.3-883s21c1
Sequence:CCGGTCGGGTAGTTCCCAACTATACCTCGAGGTATAGTTGGGAACTACCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029212.3-390s21c1
Sequence:CCGGCTATCACTGTCACTCTATATGCTCGAGCATATAGAGTGACAGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029212.3-1916s21c1
Sequence:CCGGGAGAAGATGGAGCAGATATTGCTCGAGCAATATCTGCTCCATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029212.3-1216s21c1
Sequence:CCGGACCACTGAAATCTCGTCTATACTCGAGTATAGACGAGATTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029212
CCDC33 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 33
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029212.1-1060s1c1
Sequence:CCGGCCAATGAACTTTGATGTGCCTCTCGAGAGGCACATCAAAGTTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029212.1-445s1c1
Sequence:CCGGGCTCCCTGTAATAAGGAGACTCTCGAGAGTCTCCTTATTACAGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029212.3-682s21c1
Sequence:CCGGCTTCCACCCATACCAATTTAACTCGAGTTAAATTGGTATGGGTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029212.3-883s21c1
Sequence:CCGGTCGGGTAGTTCCCAACTATACCTCGAGGTATAGTTGGGAACTACCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029212.3-390s21c1
Sequence:CCGGCTATCACTGTCACTCTATATGCTCGAGCATATAGAGTGACAGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029212.3-1916s21c1
Sequence:CCGGGAGAAGATGGAGCAGATATTGCTCGAGCAATATCTGCTCCATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029212.3-1216s21c1
Sequence:CCGGACCACTGAAATCTCGTCTATACTCGAGTATAGACGAGATTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029212
CCDC33 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 33
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029212.1-1060s1c1
Sequence:CCGGCCAATGAACTTTGATGTGCCTCTCGAGAGGCACATCAAAGTTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029212.1-445s1c1
Sequence:CCGGGCTCCCTGTAATAAGGAGACTCTCGAGAGTCTCCTTATTACAGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029212.3-682s21c1
Sequence:CCGGCTTCCACCCATACCAATTTAACTCGAGTTAAATTGGTATGGGTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029212.3-883s21c1
Sequence:CCGGTCGGGTAGTTCCCAACTATACCTCGAGGTATAGTTGGGAACTACCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029212.3-390s21c1
Sequence:CCGGCTATCACTGTCACTCTATATGCTCGAGCATATAGAGTGACAGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029212.3-1916s21c1
Sequence:CCGGGAGAAGATGGAGCAGATATTGCTCGAGCAATATCTGCTCCATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029212.3-1216s21c1
Sequence:CCGGACCACTGAAATCTCGTCTATACTCGAGTATAGACGAGATTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks