EMAIL THIS PAGE TO A FRIEND

CCDC34

coiled-coil domain containing 34

102 Gene Product Result for
Synonyms: NY-REN-41 RAMA3
UniProtKB ID: Q96HJ3, B2R8G2, Q8IX69, Q9H2A6, Q9Y599
Gene ID:
Mouse(68201) coiled-coil domain containing 34
Rat(362187) coiled-coil domain containing 34
chicken(421609) coiled-coil domain containing 34
cow(505831) coiled-coil domain containing 34
domestic cat(101082435) coiled-coil domain containing 34
dog(476895) coiled-coil domain containing 34
domestic guinea pig(100724452) coiled-coil domain containing 34
naked mole-rat(101716626) coiled-coil domain containing 34
sheep(101116505) coiled-coil domain containing 34
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026613 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026613 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026613 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080654 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080654 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080654 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU075431 MISSION® esiRNA esiRNA targeting mouse Ccdc34 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030771 Rosetta Predictions human pricing
NM_080654 Rosetta Predictions human pricing
NM_001108587 Rosetta Predictions rat pricing
NM_026613 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030771 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127728 predicted 212
2 SASI_Hs01_00127729 predicted 266
3 SASI_Hs01_00127730 predicted 213
4 SASI_Hs01_00127731 predicted 223
5 SASI_Hs01_00127732 predicted 335
6 SASI_Hs01_00127733 predicted 257
7 SASI_Hs01_00127734 predicted 259
8 SASI_Hs01_00127735 predicted 328
9 SASI_Hs01_00127736 predicted 272
10 SASI_Hs01_00127737 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080654 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149414 predicted 217
2 SASI_Hs01_00149415 predicted 257
3 SASI_Hs01_00149416 predicted 213
4 SASI_Hs01_00149417 predicted 230
5 SASI_Hs01_00149418 predicted 335
6 SASI_Hs01_00149419 predicted 265
7 SASI_Hs01_00149420 predicted 263
8 SASI_Hs01_00149421 predicted 327
9 SASI_Hs01_00149422 predicted 279
10 SASI_Hs01_00149423 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108587 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240109 predicted 1195
2 SASI_Rn02_00240110 predicted 1177
3 SASI_Rn02_00240111 predicted 1149
4 SASI_Rn02_00240112 predicted 1212
5 SASI_Rn02_00240113 predicted 239
6 SASI_Rn02_00240114 predicted 981
7 SASI_Rn02_00240115 predicted 1370
8 SASI_Rn02_00240116 predicted 431
9 SASI_Rn02_00240117 predicted 1077
10 SASI_Rn02_00240118 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026613 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035516 predicted 1152
2 SASI_Mm01_00035517 predicted 1128
3 SASI_Mm01_00035518 predicted 1157
4 SASI_Mm01_00035519 predicted 1152
5 SASI_Mm01_00035520 predicted 1148
6 SASI_Mm01_00035521 predicted 1156
7 SASI_Mm01_00035522 predicted 1146
8 SASI_Mm02_00330577 predicted 1082
9 SASI_Mm01_00035523 predicted 1145
10 SASI_Mm01_00035525 predicted 1056
11 SASI_Mm01_00035524 predicted 1068
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026613
VALIDATED
CCDC34 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 34
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026613.4-530s21c1
Sequence:CCGGAGGAATTAAATCAGCAAATAGCTCGAGCTATTTGCTGATTTAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026613.4-990s21c1
Sequence:CCGGTCCTTGGAAGCCAATTCATATCTCGAGATATGAATTGGCTTCCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026613.4-1086s21c1
Sequence:CCGGGTCATCCCTGGCAGTTCATAACTCGAGTTATGAACTGCCAGGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216027    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026613.3-1204s1c1
Sequence:CCGGCCTAATCAGTAAATCAACATTCTCGAGAATGTTGATTTACTGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026613.3-963s1c1
Sequence:CCGGCCAATTCCTTGGAAGCCAATTCTCGAGAATTGGCTTCCAAGGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026613.4-1836s21c1
Sequence:CCGGTGCTCTGCAGCACCGAAATAACTCGAGTTATTTCGGTGCTGCAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026613.4-150s21c1
Sequence:CCGGCGTCGACCTCTTAGTGGATTCCTCGAGGAATCCACTAAGAGGTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026613.2-1018s1c1
Sequence:CCGGCCCGGAAAGAAGAGTAAACGACTCGAGTCGTTTACTCTTCTTTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026613.2-1071s1c1
Sequence:CCGGCCTGGCAGTTCATAATGCCAACTCGAGTTGGCATTATGAACTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026613.2-1081s1c1
Sequence:CCGGCATAATGCCAAGAGCAGTCTTCTCGAGAAGACTGCTCTTGGCATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026613
VALIDATED
CCDC34 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 34
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026613.4-530s21c1
Sequence:CCGGAGGAATTAAATCAGCAAATAGCTCGAGCTATTTGCTGATTTAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026613.4-990s21c1
Sequence:CCGGTCCTTGGAAGCCAATTCATATCTCGAGATATGAATTGGCTTCCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026613.4-1086s21c1
Sequence:CCGGGTCATCCCTGGCAGTTCATAACTCGAGTTATGAACTGCCAGGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216027    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026613.3-1204s1c1
Sequence:CCGGCCTAATCAGTAAATCAACATTCTCGAGAATGTTGATTTACTGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026613.3-963s1c1
Sequence:CCGGCCAATTCCTTGGAAGCCAATTCTCGAGAATTGGCTTCCAAGGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026613.4-1836s21c1
Sequence:CCGGTGCTCTGCAGCACCGAAATAACTCGAGTTATTTCGGTGCTGCAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026613.4-150s21c1
Sequence:CCGGCGTCGACCTCTTAGTGGATTCCTCGAGGAATCCACTAAGAGGTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026613.2-1018s1c1
Sequence:CCGGCCCGGAAAGAAGAGTAAACGACTCGAGTCGTTTACTCTTCTTTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026613.2-1071s1c1
Sequence:CCGGCCTGGCAGTTCATAATGCCAACTCGAGTTGGCATTATGAACTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026613.2-1081s1c1
Sequence:CCGGCATAATGCCAAGAGCAGTCTTCTCGAGAAGACTGCTCTTGGCATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026613
VALIDATED
CCDC34 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 34
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026613.4-530s21c1
Sequence:CCGGAGGAATTAAATCAGCAAATAGCTCGAGCTATTTGCTGATTTAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026613.4-990s21c1
Sequence:CCGGTCCTTGGAAGCCAATTCATATCTCGAGATATGAATTGGCTTCCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026613.4-1086s21c1
Sequence:CCGGGTCATCCCTGGCAGTTCATAACTCGAGTTATGAACTGCCAGGGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216027    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026613.3-1204s1c1
Sequence:CCGGCCTAATCAGTAAATCAACATTCTCGAGAATGTTGATTTACTGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026613.3-963s1c1
Sequence:CCGGCCAATTCCTTGGAAGCCAATTCTCGAGAATTGGCTTCCAAGGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026613.4-1836s21c1
Sequence:CCGGTGCTCTGCAGCACCGAAATAACTCGAGTTATTTCGGTGCTGCAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026613.4-150s21c1
Sequence:CCGGCGTCGACCTCTTAGTGGATTCCTCGAGGAATCCACTAAGAGGTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195982    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026613.2-1018s1c1
Sequence:CCGGCCCGGAAAGAAGAGTAAACGACTCGAGTCGTTTACTCTTCTTTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026613.2-1071s1c1
Sequence:CCGGCCTGGCAGTTCATAATGCCAACTCGAGTTGGCATTATGAACTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026613.2-1081s1c1
Sequence:CCGGCATAATGCCAAGAGCAGTCTTCTCGAGAAGACTGCTCTTGGCATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080654
VALIDATED
CCDC34 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 34
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_080654.1-311s1c1
Sequence:CCGGGATGAAGATGCCCATGATTCACTCGAGTGAATCATGGGCATCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080654.1-406s1c1
Sequence:CCGGCCAAGAAGAACAGAAACAGGTCTCGAGACCTGTTTCTGTTCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080654.1-296s1c1
Sequence:CCGGGATGAGGAAGACGTGGATGAACTCGAGTTCATCCACGTCTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080654.1-284s1c1
Sequence:CCGGGAAGACGTGGATGATGAGGAACTCGAGTTCCTCATCATCCACGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_080654.1-452s1c1
Sequence:CCGGCCATGGGAGGTGTGGTTTATTCTCGAGAATAAACCACACCTCCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_080654.1-595s1c1
Sequence:CCGGGCACAAGGAATGGGTTCAGAACTCGAGTTCTGAACCCATTCCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080654.1-502s1c1
Sequence:CCGGGCAACTGAAAGCTCTAGAGGACTCGAGTCCTCTAGAGCTTTCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080654.1-646s1c1
Sequence:CCGGGATACACACATTGACATCTCTCTCGAGAGAGATGTCAATGTGTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_080654.1-506s1c1
Sequence:CCGGCTGAAAGCTCTAGAGGAATTACTCGAGTAATTCCTCTAGAGCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080654
VALIDATED
CCDC34 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 34
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_080654.1-311s1c1
Sequence:CCGGGATGAAGATGCCCATGATTCACTCGAGTGAATCATGGGCATCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080654.1-406s1c1
Sequence:CCGGCCAAGAAGAACAGAAACAGGTCTCGAGACCTGTTTCTGTTCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080654.1-296s1c1
Sequence:CCGGGATGAGGAAGACGTGGATGAACTCGAGTTCATCCACGTCTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080654.1-284s1c1
Sequence:CCGGGAAGACGTGGATGATGAGGAACTCGAGTTCCTCATCATCCACGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_080654.1-452s1c1
Sequence:CCGGCCATGGGAGGTGTGGTTTATTCTCGAGAATAAACCACACCTCCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_080654.1-595s1c1
Sequence:CCGGGCACAAGGAATGGGTTCAGAACTCGAGTTCTGAACCCATTCCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080654.1-502s1c1
Sequence:CCGGGCAACTGAAAGCTCTAGAGGACTCGAGTCCTCTAGAGCTTTCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080654.1-646s1c1
Sequence:CCGGGATACACACATTGACATCTCTCTCGAGAGAGATGTCAATGTGTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_080654.1-506s1c1
Sequence:CCGGCTGAAAGCTCTAGAGGAATTACTCGAGTAATTCCTCTAGAGCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080654
VALIDATED
CCDC34 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 34
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_080654.1-311s1c1
Sequence:CCGGGATGAAGATGCCCATGATTCACTCGAGTGAATCATGGGCATCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080654.1-406s1c1
Sequence:CCGGCCAAGAAGAACAGAAACAGGTCTCGAGACCTGTTTCTGTTCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080654.1-296s1c1
Sequence:CCGGGATGAGGAAGACGTGGATGAACTCGAGTTCATCCACGTCTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080654.1-284s1c1
Sequence:CCGGGAAGACGTGGATGATGAGGAACTCGAGTTCCTCATCATCCACGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_080654.1-452s1c1
Sequence:CCGGCCATGGGAGGTGTGGTTTATTCTCGAGAATAAACCACACCTCCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_080654.1-595s1c1
Sequence:CCGGGCACAAGGAATGGGTTCAGAACTCGAGTTCTGAACCCATTCCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_080654.1-502s1c1
Sequence:CCGGGCAACTGAAAGCTCTAGAGGACTCGAGTCCTCTAGAGCTTTCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080654.1-646s1c1
Sequence:CCGGGATACACACATTGACATCTCTCTCGAGAGAGATGTCAATGTGTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_080654.1-506s1c1
Sequence:CCGGCTGAAAGCTCTAGAGGAATTACTCGAGTAATTCCTCTAGAGCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks