EMAIL THIS PAGE TO A FRIEND

CCDC36

coiled-coil domain containing 36

150 Gene Product Result for
Synonyms: CT74
UniProtKB ID: Q8IYA8, C9JJL0, Q05DG9, Q96LP7
Gene ID:
Mouse(434438) coiled-coil domain containing 36
Rat(680018) coiled-coil domain containing 36
chicken(771087) coiled-coil domain containing 36
cow(520504) coiled-coil domain containing 36
Horse(100062976) coiled-coil domain containing 36
domestic cat(101082807) coiled-coil domain containing 36
dog(100688973) coiled-coil domain containing 36
chicken(101666320) coiled-coil domain containing 36
chicken(101750778) coiled-coil domain containing 36
sheep(101105694) coiled-coil domain containing 36
Domestic Rabbit(100338401) coiled-coil domain containing 36
naked mole-rat(101709039) coiled-coil domain containing 36
domestic guinea pig(100727985) coiled-coil domain containing 36
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178173 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178173 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178173 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001135198 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001135198 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001135198 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178173 Rosetta Predictions human pricing
XM_001055346 Rosetta Predictions rat pricing
XM_486258 Rosetta Predictions mouse pricing
XM_910378 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033752 predicted 910
2 SASI_Hs01_00033753 predicted 1565
3 SASI_Hs01_00033754 predicted 442
4 SASI_Hs01_00033755 predicted 860
5 SASI_Hs02_00369587 predicted 2108
6 SASI_Hs01_00033756 predicted 1507
7 SASI_Hs01_00033757 predicted 1776
8 SASI_Hs01_00033758 predicted 447
9 SASI_Hs01_00033759 predicted 1221
10 SASI_Hs01_00033760 predicted 515
11 SASI_Hs01_00033761 predicted 1673
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055346 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279269 predicted 216
2 SASI_Rn02_00279270 predicted 488
3 SASI_Rn02_00279271 predicted 712
4 SASI_Rn02_00279272 predicted 675
5 SASI_Rn02_00279273 predicted 282
6 SASI_Rn02_00279274 predicted 1232
7 SASI_Rn02_00279275 predicted 198
8 SASI_Rn02_00279276 predicted 411
9 SASI_Rn02_00279277 predicted 793
10 SASI_Rn02_00279278 predicted 1016
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_486258 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00426839 predicted 757
2 SASI_Mm02_00426840 predicted 1875
3 SASI_Mm02_00426841 predicted 1189
4 SASI_Mm02_00426842 predicted 309
5 SASI_Mm02_00426843 predicted 318
6 SASI_Mm02_00426844 predicted 1842
7 SASI_Mm02_00426845 predicted 299
8 SASI_Mm02_00426846 predicted 1575
9 SASI_Mm02_00426847 predicted 211
10 SASI_Mm02_00426848 predicted 1861
11 SASI_Mm01_00222786 predicted 2023
12 SASI_Mm01_00222787 predicted 2065
13 SASI_Mm01_00222788 predicted 2097
14 SASI_Mm01_00222789 predicted 2044
15 SASI_Mm01_00222790 predicted 2138
16 SASI_Mm01_00222791 predicted 2216
17 SASI_Mm01_00222792 predicted 2103
18 SASI_Mm01_00222793 predicted 2214
19 SASI_Mm01_00222794 predicted 2007
20 SASI_Mm01_00222795 predicted 2098
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_910378 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00435515 predicted 759
2 SASI_Mm02_00435516 predicted 1873
3 SASI_Mm02_00435517 predicted 1193
4 SASI_Mm02_00435518 predicted 310
5 SASI_Mm02_00435519 predicted 317
6 SASI_Mm02_00435520 predicted 1839
7 SASI_Mm02_00435521 predicted 305
8 SASI_Mm02_00435522 predicted 1577
9 SASI_Mm02_00435523 predicted 210
10 SASI_Mm02_00435524 predicted 1866
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178173
CCDC36 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 36
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178173.2-2205s1c1
Sequence:CCGGGAAAGAGAAATTGCAGGACATCTCGAGATGTCCTGCAATTTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178173.2-2356s1c1
Sequence:CCGGCAAGGATTAAGTGCATCCTTACTCGAGTAAGGATGCACTTAATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178173.2-1595s1c1
Sequence:CCGGGCATTAAGAATGCCTGCCAAACTCGAGTTTGGCAGGCATTCTTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178173.2-518s1c1
Sequence:CCGGGATCTCAGTTCTGTCCAGAAACTCGAGTTTCTGGACAGAACTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178173.2-1178s1c1
Sequence:CCGGCTCCAGTGAAAGACAGTGCTTCTCGAGAAGCACTGTCTTTCACTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139721    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178173.2-2236s1c1
Sequence:CCGGCAACAGCAGAAAGTCCCTGAACTCGAGTTCAGGGACTTTCTGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178173.2-925s1c1
Sequence:CCGGGAGACTATACAGGCCCAGAATCTCGAGATTCTGGGCCTGTATAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178173.2-2069s1c1
Sequence:CCGGGTGACCTCAATCTCGGATGTTCTCGAGAACATCCGAGATTGAGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178173.2-2113s1c1
Sequence:CCGGGCAGGAAAGAATTTGCTCTATCTCGAGATAGAGCAAATTCTTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178173
CCDC36 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 36
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178173.2-2205s1c1
Sequence:CCGGGAAAGAGAAATTGCAGGACATCTCGAGATGTCCTGCAATTTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178173.2-2356s1c1
Sequence:CCGGCAAGGATTAAGTGCATCCTTACTCGAGTAAGGATGCACTTAATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178173.2-1595s1c1
Sequence:CCGGGCATTAAGAATGCCTGCCAAACTCGAGTTTGGCAGGCATTCTTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178173.2-518s1c1
Sequence:CCGGGATCTCAGTTCTGTCCAGAAACTCGAGTTTCTGGACAGAACTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178173.2-1178s1c1
Sequence:CCGGCTCCAGTGAAAGACAGTGCTTCTCGAGAAGCACTGTCTTTCACTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139721    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178173.2-2236s1c1
Sequence:CCGGCAACAGCAGAAAGTCCCTGAACTCGAGTTCAGGGACTTTCTGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178173.2-925s1c1
Sequence:CCGGGAGACTATACAGGCCCAGAATCTCGAGATTCTGGGCCTGTATAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178173.2-2069s1c1
Sequence:CCGGGTGACCTCAATCTCGGATGTTCTCGAGAACATCCGAGATTGAGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178173.2-2113s1c1
Sequence:CCGGGCAGGAAAGAATTTGCTCTATCTCGAGATAGAGCAAATTCTTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178173
CCDC36 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 36
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178173.2-2205s1c1
Sequence:CCGGGAAAGAGAAATTGCAGGACATCTCGAGATGTCCTGCAATTTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178173.2-2356s1c1
Sequence:CCGGCAAGGATTAAGTGCATCCTTACTCGAGTAAGGATGCACTTAATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178173.2-1595s1c1
Sequence:CCGGGCATTAAGAATGCCTGCCAAACTCGAGTTTGGCAGGCATTCTTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178173.2-518s1c1
Sequence:CCGGGATCTCAGTTCTGTCCAGAAACTCGAGTTTCTGGACAGAACTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178173.2-1178s1c1
Sequence:CCGGCTCCAGTGAAAGACAGTGCTTCTCGAGAAGCACTGTCTTTCACTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139721    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178173.2-2236s1c1
Sequence:CCGGCAACAGCAGAAAGTCCCTGAACTCGAGTTCAGGGACTTTCTGCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178173.2-925s1c1
Sequence:CCGGGAGACTATACAGGCCCAGAATCTCGAGATTCTGGGCCTGTATAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178173.2-2069s1c1
Sequence:CCGGGTGACCTCAATCTCGGATGTTCTCGAGAACATCCGAGATTGAGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178173.2-2113s1c1
Sequence:CCGGGCAGGAAAGAATTTGCTCTATCTCGAGATAGAGCAAATTCTTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001135198
CCDC36 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 36
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001135198.1-2194s21c1
Sequence:CCGGCATGTTACAGGGTACACTATTCTCGAGAATAGTGTACCCTGTAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135198.1-234s21c1
Sequence:CCGGGTGGATAGTGAACCTAGTATTCTCGAGAATACTAGGTTCACTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135198.1-1189s21c1
Sequence:CCGGAGCGGGACGTAAGTAAGTTTGCTCGAGCAAACTTACTTACGTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135198.1-1710s21c1
Sequence:CCGGTTTGATAGCAGCGATGATAATCTCGAGATTATCATCGCTGCTATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135198.1-1673s21c1
Sequence:CCGGTAAGAAGGGAGGGACGAATTTCTCGAGAAATTCGTCCCTCCCTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001135198
CCDC36 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 36
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001135198.1-2194s21c1
Sequence:CCGGCATGTTACAGGGTACACTATTCTCGAGAATAGTGTACCCTGTAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135198.1-234s21c1
Sequence:CCGGGTGGATAGTGAACCTAGTATTCTCGAGAATACTAGGTTCACTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135198.1-1189s21c1
Sequence:CCGGAGCGGGACGTAAGTAAGTTTGCTCGAGCAAACTTACTTACGTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135198.1-1710s21c1
Sequence:CCGGTTTGATAGCAGCGATGATAATCTCGAGATTATCATCGCTGCTATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135198.1-1673s21c1
Sequence:CCGGTAAGAAGGGAGGGACGAATTTCTCGAGAAATTCGTCCCTCCCTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001135198
CCDC36 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 36
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001135198.1-2194s21c1
Sequence:CCGGCATGTTACAGGGTACACTATTCTCGAGAATAGTGTACCCTGTAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135198.1-234s21c1
Sequence:CCGGGTGGATAGTGAACCTAGTATTCTCGAGAATACTAGGTTCACTATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135198.1-1189s21c1
Sequence:CCGGAGCGGGACGTAAGTAAGTTTGCTCGAGCAAACTTACTTACGTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135198.1-1710s21c1
Sequence:CCGGTTTGATAGCAGCGATGATAATCTCGAGATTATCATCGCTGCTATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001135198.1-1673s21c1
Sequence:CCGGTAAGAAGGGAGGGACGAATTTCTCGAGAAATTCGTCCCTCCCTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks