EMAIL THIS PAGE TO A FRIEND

CCDC37

coiled-coil domain containing 37

82 Gene Product Result for
UniProtKB ID: Q494V2, D3DNA8, Q494V1, Q494V4, Q8N838
Gene ID:
Mouse(243538) coiled-coil domain containing 37
Rat(297444) coiled-coil domain containing 37
domestic guinea pig(100718693) coiled-coil domain containing 37
naked mole-rat(101707242) coiled-coil domain containing 37
sheep(101117883) coiled-coil domain containing 37
Zebrafish(767793) coiled-coil domain containing 37
cow(519687) coiled-coil domain containing 37
domestic cat(101093589) coiled-coil domain containing 37
dog(609082) coiled-coil domain containing 37
chicken(427589) coiled-coil domain containing 37
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182628 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182628 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182628 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001479575 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001479575 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001479575 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173775 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173775 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173775 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182628 Rosetta Predictions human pricing
XM_001076288 Rosetta Predictions rat pricing
XM_216219 Rosetta Predictions rat pricing
XM_001479575 Rosetta Predictions mouse pricing
XM_001479586 Rosetta Predictions mouse pricing
XM_001480389 Rosetta Predictions mouse pricing
XM_001480392 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236141 predicted 864
2 SASI_Hs01_00236142 predicted 806
3 SASI_Hs01_00236143 predicted 528
4 SASI_Hs01_00236144 predicted 1041
5 SASI_Hs02_00370781 predicted 853
6 SASI_Hs01_00236146 predicted 823
7 SASI_Hs01_00236147 predicted 302
8 SASI_Hs01_00236148 predicted 294
9 SASI_Hs01_00236149 predicted 1860
10 SASI_Hs01_00236150 predicted 1002
11 SASI_Hs01_00236145 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076288 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352706 predicted 1045
2 SASI_Rn02_00352707 predicted 927
3 SASI_Rn02_00352708 predicted 633
4 SASI_Rn02_00352709 predicted 1576
5 SASI_Rn02_00352710 predicted 359
6 SASI_Rn02_00352711 predicted 1845
7 SASI_Rn02_00352712 predicted 1311
8 SASI_Rn02_00352713 predicted 287
9 SASI_Rn02_00352714 predicted 870
10 SASI_Rn02_00352715 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216219 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376480 predicted 768
2 SASI_Rn02_00376481 predicted 817
3 SASI_Rn02_00376482 predicted 705
4 SASI_Rn02_00376483 predicted 586
5 SASI_Rn02_00376484 predicted 413
6 SASI_Rn02_00376485 predicted 1359
7 SASI_Rn02_00376486 predicted 1613
8 SASI_Rn02_00376487 predicted 1078
9 SASI_Rn02_00376488 predicted 355
10 SASI_Rn02_00376489 predicted 647
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479575 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00411042 predicted 1583
2 SASI_Mm02_00411043 predicted 1562
3 SASI_Mm02_00411044 predicted 560
4 SASI_Mm02_00411045 predicted 969
5 SASI_Mm02_00411046 predicted 844
6 SASI_Mm02_00411047 predicted 869
7 SASI_Mm02_00411048 predicted 1284
8 SASI_Mm02_00411049 predicted 1066
9 SASI_Mm02_00411050 predicted 1079
10 SASI_Mm02_00411051 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479586 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00411117 predicted 1316
2 SASI_Mm02_00411118 predicted 1287
3 SASI_Mm02_00411119 predicted 292
4 SASI_Mm02_00411120 predicted 700
5 SASI_Mm02_00411121 predicted 578
6 SASI_Mm02_00411122 predicted 608
7 SASI_Mm02_00411123 predicted 1017
8 SASI_Mm02_00411124 predicted 798
9 SASI_Mm02_00411125 predicted 813
10 SASI_Mm02_00411126 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480389 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00417254 predicted 1589
2 SASI_Mm02_00417255 predicted 1448
3 SASI_Mm02_00417256 predicted 1556
4 SASI_Mm02_00417257 predicted 1707
5 SASI_Mm02_00417258 predicted 1499
6 SASI_Mm02_00417259 predicted 1561
7 SASI_Mm02_00417260 predicted 1600
8 SASI_Mm02_00417261 predicted 1435
9 SASI_Mm02_00417262 predicted 1816
10 SASI_Mm02_00417263 predicted 1809
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00417284 predicted 1311
2 SASI_Mm02_00417285 predicted 1182
3 SASI_Mm02_00417286 predicted 1287
4 SASI_Mm02_00417287 predicted 1437
5 SASI_Mm02_00417288 predicted 1228
6 SASI_Mm02_00417289 predicted 1288
7 SASI_Mm02_00417290 predicted 1330
8 SASI_Mm02_00417291 predicted 1166
9 SASI_Mm02_00417292 predicted 1548
10 SASI_Mm02_00417293 predicted 1538
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182628
CCDC37 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 37
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182628.2-701s21c1
Sequence:CCGGACGAGTTCGTCAGGGAGAATGCTCGAGCATTCTCCCTGACGAACTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182628.2-295s21c1
Sequence:CCGGAGAGATCAGGAGCGGAATAAGCTCGAGCTTATTCCGCTCCTGATCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182628.2-249s21c1
Sequence:CCGGAGCGAACCCTTTCCACTTATCCTCGAGGATAAGTGGAAAGGGTTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182628.2-552s21c1
Sequence:CCGGCATTAAGCAGAAGCGGCAAATCTCGAGATTTGCCGCTTCTGCTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182628.2-1719s21c1
Sequence:CCGGGCGCATCAGACTTCGAGAAGACTCGAGTCTTCTCGAAGTCTGATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182628.1-858s1c1
Sequence:CCGGGAAGCATTACAAGGTCTATAACTCGAGTTATAGACCTTGTAATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182628.1-807s1c1
Sequence:CCGGCACCCAGATTGTTAATATCAACTCGAGTTGATATTAACAATCTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182628.1-1611s1c1
Sequence:CCGGGCAGATGCTGACCATCATTGACTCGAGTCAATGATGGTCAGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182628.1-1859s1c1
Sequence:CCGGCCCACAGGATCAAACAACAGTCTCGAGACTGTTGTTTGATCCTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182628
CCDC37 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 37
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182628.2-701s21c1
Sequence:CCGGACGAGTTCGTCAGGGAGAATGCTCGAGCATTCTCCCTGACGAACTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182628.2-295s21c1
Sequence:CCGGAGAGATCAGGAGCGGAATAAGCTCGAGCTTATTCCGCTCCTGATCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182628.2-249s21c1
Sequence:CCGGAGCGAACCCTTTCCACTTATCCTCGAGGATAAGTGGAAAGGGTTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182628.2-552s21c1
Sequence:CCGGCATTAAGCAGAAGCGGCAAATCTCGAGATTTGCCGCTTCTGCTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182628.2-1719s21c1
Sequence:CCGGGCGCATCAGACTTCGAGAAGACTCGAGTCTTCTCGAAGTCTGATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182628.1-858s1c1
Sequence:CCGGGAAGCATTACAAGGTCTATAACTCGAGTTATAGACCTTGTAATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182628.1-807s1c1
Sequence:CCGGCACCCAGATTGTTAATATCAACTCGAGTTGATATTAACAATCTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182628.1-1611s1c1
Sequence:CCGGGCAGATGCTGACCATCATTGACTCGAGTCAATGATGGTCAGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182628.1-1859s1c1
Sequence:CCGGCCCACAGGATCAAACAACAGTCTCGAGACTGTTGTTTGATCCTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182628
CCDC37 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 37
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182628.2-701s21c1
Sequence:CCGGACGAGTTCGTCAGGGAGAATGCTCGAGCATTCTCCCTGACGAACTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182628.2-295s21c1
Sequence:CCGGAGAGATCAGGAGCGGAATAAGCTCGAGCTTATTCCGCTCCTGATCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182628.2-249s21c1
Sequence:CCGGAGCGAACCCTTTCCACTTATCCTCGAGGATAAGTGGAAAGGGTTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182628.2-552s21c1
Sequence:CCGGCATTAAGCAGAAGCGGCAAATCTCGAGATTTGCCGCTTCTGCTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182628.2-1719s21c1
Sequence:CCGGGCGCATCAGACTTCGAGAAGACTCGAGTCTTCTCGAAGTCTGATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167389    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182628.1-858s1c1
Sequence:CCGGGAAGCATTACAAGGTCTATAACTCGAGTTATAGACCTTGTAATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182628.1-807s1c1
Sequence:CCGGCACCCAGATTGTTAATATCAACTCGAGTTGATATTAACAATCTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182628.1-1611s1c1
Sequence:CCGGGCAGATGCTGACCATCATTGACTCGAGTCAATGATGGTCAGCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182628.1-1859s1c1
Sequence:CCGGCCCACAGGATCAAACAACAGTCTCGAGACTGTTGTTTGATCCTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001479575
CCDC37 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 37
Mouse
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000217047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001479575.1-247s1c1
Sequence:CCGGCAAGTAACCCTTTCCACATATCTCGAGATATGTGGAAAGGGTTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001479575
CCDC37 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 37
Mouse
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000217047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001479575.1-247s1c1
Sequence:CCGGCAAGTAACCCTTTCCACATATCTCGAGATATGTGGAAAGGGTTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001479575
CCDC37 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 37
Mouse
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000217047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001479575.1-247s1c1
Sequence:CCGGCAAGTAACCCTTTCCACATATCTCGAGATATGTGGAAAGGGTTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173775
CCDC37 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 37
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173775.2-2506s1c1
Sequence:CCGGCCATCCACCAGTCATCAAAGTCTCGAGACTTTGATGACTGGTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173775.2-2572s1c1
Sequence:CCGGGATGCTCTTCTTCTTCACTTACTCGAGTAAGTGAAGAAGAAGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173775.2-2488s1c1
Sequence:CCGGGAAATTGATAAGCCGTTCCCACTCGAGTGGGAACGGCTTATCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173775.2-2554s1c1
Sequence:CCGGCAACAAGGACAAGGAGGAGATCTCGAGATCTCCTCCTTGTCCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173775.2-2545s1c1
Sequence:CCGGGACGCTGATCAACAAGGACAACTCGAGTTGTCCTTGTTGATCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173775.2-2047s1c1
Sequence:CCGGCAAGGAGGTCAACCTTCTGAACTCGAGTTCAGAAGGTTGACCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173775
CCDC37 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 37
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173775.2-2506s1c1
Sequence:CCGGCCATCCACCAGTCATCAAAGTCTCGAGACTTTGATGACTGGTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173775.2-2572s1c1
Sequence:CCGGGATGCTCTTCTTCTTCACTTACTCGAGTAAGTGAAGAAGAAGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173775.2-2488s1c1
Sequence:CCGGGAAATTGATAAGCCGTTCCCACTCGAGTGGGAACGGCTTATCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173775.2-2554s1c1
Sequence:CCGGCAACAAGGACAAGGAGGAGATCTCGAGATCTCCTCCTTGTCCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173775.2-2545s1c1
Sequence:CCGGGACGCTGATCAACAAGGACAACTCGAGTTGTCCTTGTTGATCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173775.2-2047s1c1
Sequence:CCGGCAAGGAGGTCAACCTTCTGAACTCGAGTTCAGAAGGTTGACCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173775
CCDC37 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 37
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173775.2-2506s1c1
Sequence:CCGGCCATCCACCAGTCATCAAAGTCTCGAGACTTTGATGACTGGTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173775.2-2572s1c1
Sequence:CCGGGATGCTCTTCTTCTTCACTTACTCGAGTAAGTGAAGAAGAAGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173775.2-2488s1c1
Sequence:CCGGGAAATTGATAAGCCGTTCCCACTCGAGTGGGAACGGCTTATCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173775.2-2554s1c1
Sequence:CCGGCAACAAGGACAAGGAGGAGATCTCGAGATCTCCTCCTTGTCCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173775.2-2545s1c1
Sequence:CCGGGACGCTGATCAACAAGGACAACTCGAGTTGTCCTTGTTGATCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173775.2-2047s1c1
Sequence:CCGGCAAGGAGGTCAACCTTCTGAACTCGAGTTCAGAAGGTTGACCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks