EMAIL THIS PAGE TO A FRIEND

CCDC38

coiled-coil domain containing 38

58 Gene Product Result for
UniProtKB ID: Q502W7, Q8N835
Gene ID:
Mouse(237465) coiled-coil domain containing 38
Rat(500823) coiled-coil domain containing 38
domestic cat(101092034) coiled-coil domain containing 38
cow(517752) coiled-coil domain containing 38
Horse(100065514) coiled-coil domain containing 38
dog(611996) coiled-coil domain containing 38
sheep(101118778) coiled-coil domain containing 38
naked mole-rat(101701464) coiled-coil domain containing 38
domestic guinea pig(100723119) coiled-coil domain containing 38
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175488 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175488 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175488 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182496 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182496 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182496 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182496 Rosetta Predictions human pricing
XM_001080322 Rosetta Predictions rat pricing
XM_576213 Rosetta Predictions rat pricing
NM_175488 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182496 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149165 predicted 1457
2 SASI_Hs01_00149166 predicted 930
3 SASI_Hs01_00149168 predicted 447
4 SASI_Hs02_00370535 predicted 1281
5 SASI_Hs01_00149169 predicted 1174
6 SASI_Hs01_00149170 predicted 594
7 SASI_Hs01_00149171 predicted 324
8 SASI_Hs01_00149174 predicted 1369
9 SASI_Hs02_00370536 predicted 1539
10 SASI_Hs02_00370537 predicted 1691
11 SASI_Hs01_00149167 predicted 864
12 SASI_Hs01_00149172 predicted 1223
13 SASI_Hs01_00149173 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080322 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367568 predicted 1073
2 SASI_Rn02_00367569 predicted 1549
3 SASI_Rn02_00367570 predicted 1192
4 SASI_Rn02_00367571 predicted 752
5 SASI_Rn02_00367572 predicted 1295
6 SASI_Rn02_00367573 predicted 427
7 SASI_Rn02_00367574 predicted 1374
8 SASI_Rn02_00367575 predicted 851
9 SASI_Rn02_00367576 predicted 1399
10 SASI_Rn02_00367577 predicted 1741
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576213 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404867 predicted 211
2 SASI_Rn02_00404868 predicted 249
3 SASI_Rn02_00404869 predicted 206
4 SASI_Rn02_00404870 predicted 253
5 SASI_Rn02_00404871 predicted 246
6 SASI_Rn02_00404872 predicted 264
7 SASI_Rn02_00404873 predicted 209
8 SASI_Rn02_00404874 predicted 251
9 SASI_Rn02_00404875 predicted 244
10 SASI_Rn02_00404876 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175488 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174310 predicted 749
2 SASI_Mm01_00174311 predicted 1059
3 SASI_Mm02_00346405 predicted 1447
4 SASI_Mm01_00174312 predicted 1779
5 SASI_Mm01_00174313 predicted 538
6 SASI_Mm01_00174314 predicted 1132
7 SASI_Mm01_00174315 predicted 1014
8 SASI_Mm01_00174317 predicted 1315
9 SASI_Mm01_00174318 predicted 651
10 SASI_Mm01_00174319 predicted 1368
11 SASI_Mm01_00174316 predicted 1268
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175488
CCDC38 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 38
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175488.3-829s1c1
Sequence:CCGGCCTCCTCAAGGAATACATGAACTCGAGTTCATGTATTCCTTGAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181306    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175488.3-2142s1c1
Sequence:CCGGCCTTCCTCAAAGCATGAGAATCTCGAGATTCTCATGCTTTGAGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175488.3-602s1c1
Sequence:CCGGGAAAGACTCATAGCCATTAAACTCGAGTTTAATGGCTATGAGTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175488.3-1080s1c1
Sequence:CCGGGCCAAGACTCTAGGAAGTCATCTCGAGATGACTTCCTAGAGTCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175488.3-520s1c1
Sequence:CCGGCCACGAGTTTATTAACGACCACTCGAGTGGTCGTTAATAAACTCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175488
CCDC38 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 38
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175488.3-829s1c1
Sequence:CCGGCCTCCTCAAGGAATACATGAACTCGAGTTCATGTATTCCTTGAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181306    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175488.3-2142s1c1
Sequence:CCGGCCTTCCTCAAAGCATGAGAATCTCGAGATTCTCATGCTTTGAGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175488.3-602s1c1
Sequence:CCGGGAAAGACTCATAGCCATTAAACTCGAGTTTAATGGCTATGAGTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175488.3-1080s1c1
Sequence:CCGGGCCAAGACTCTAGGAAGTCATCTCGAGATGACTTCCTAGAGTCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175488.3-520s1c1
Sequence:CCGGCCACGAGTTTATTAACGACCACTCGAGTGGTCGTTAATAAACTCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175488
CCDC38 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 38
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175488.3-829s1c1
Sequence:CCGGCCTCCTCAAGGAATACATGAACTCGAGTTCATGTATTCCTTGAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181306    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175488.3-2142s1c1
Sequence:CCGGCCTTCCTCAAAGCATGAGAATCTCGAGATTCTCATGCTTTGAGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175488.3-602s1c1
Sequence:CCGGGAAAGACTCATAGCCATTAAACTCGAGTTTAATGGCTATGAGTCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175488.3-1080s1c1
Sequence:CCGGGCCAAGACTCTAGGAAGTCATCTCGAGATGACTTCCTAGAGTCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175488.3-520s1c1
Sequence:CCGGCCACGAGTTTATTAACGACCACTCGAGTGGTCGTTAATAAACTCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182496
CCDC38 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 38
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182496.1-1687s1c1
Sequence:CCGGGAGAGGATGAAACAGAAAGAACTCGAGTTCTTTCTGTTTCATCCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182496.1-1461s1c1
Sequence:CCGGGCAATTAAAGTCCAAGCTCTTCTCGAGAAGAGCTTGGACTTTAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182496.1-1201s1c1
Sequence:CCGGGATGATGAAATGGACGTTGATCTCGAGATCAACGTCCATTTCATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182496.1-324s1c1
Sequence:CCGGCAGAGATCTCTTTCTTGTCAACTCGAGTTGACAAGAAAGAGATCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182496.1-384s1c1
Sequence:CCGGGAACCGTAACATGAAAGTCTACTCGAGTAGACTTTCATGTTACGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182496.1-601s1c1
Sequence:CCGGGAGTATGCTTTGTCAACCAAACTCGAGTTTGGTTGACAAAGCATACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182496.1-1285s1c1
Sequence:CCGGGAGCAGAATCTTACTTTGTTTCTCGAGAAACAAAGTAAGATTCTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182496.1-1228s1c1
Sequence:CCGGCCAGCACTTTATTTCAAGGAACTCGAGTTCCTTGAAATAAAGTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182496.1-1423s1c1
Sequence:CCGGGCTAACTGTGTGAGAGAAGAACTCGAGTTCTTCTCTCACACAGTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182496.1-1751s1c1
Sequence:CCGGGACACCAACAGGAAAGGCTAACTCGAGTTAGCCTTTCCTGTTGGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182496.1-656s1c1
Sequence:CCGGCAATGAGGGAACGGCAACTAACTCGAGTTAGTTGCCGTTCCCTCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182496.1-512s1c1
Sequence:CCGGCTGCTCCGATTCCTAGATTAACTCGAGTTAATCTAGGAATCGGAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182496.1-1636s1c1
Sequence:CCGGGAACTGTGTGACCTCATCGAACTCGAGTTCGATGAGGTCACACAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182496
CCDC38 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 38
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182496.1-1687s1c1
Sequence:CCGGGAGAGGATGAAACAGAAAGAACTCGAGTTCTTTCTGTTTCATCCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182496.1-1461s1c1
Sequence:CCGGGCAATTAAAGTCCAAGCTCTTCTCGAGAAGAGCTTGGACTTTAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182496.1-1201s1c1
Sequence:CCGGGATGATGAAATGGACGTTGATCTCGAGATCAACGTCCATTTCATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182496.1-324s1c1
Sequence:CCGGCAGAGATCTCTTTCTTGTCAACTCGAGTTGACAAGAAAGAGATCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182496.1-384s1c1
Sequence:CCGGGAACCGTAACATGAAAGTCTACTCGAGTAGACTTTCATGTTACGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182496.1-601s1c1
Sequence:CCGGGAGTATGCTTTGTCAACCAAACTCGAGTTTGGTTGACAAAGCATACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182496.1-1285s1c1
Sequence:CCGGGAGCAGAATCTTACTTTGTTTCTCGAGAAACAAAGTAAGATTCTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182496.1-1228s1c1
Sequence:CCGGCCAGCACTTTATTTCAAGGAACTCGAGTTCCTTGAAATAAAGTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182496.1-1423s1c1
Sequence:CCGGGCTAACTGTGTGAGAGAAGAACTCGAGTTCTTCTCTCACACAGTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182496.1-1751s1c1
Sequence:CCGGGACACCAACAGGAAAGGCTAACTCGAGTTAGCCTTTCCTGTTGGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182496.1-656s1c1
Sequence:CCGGCAATGAGGGAACGGCAACTAACTCGAGTTAGTTGCCGTTCCCTCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182496.1-512s1c1
Sequence:CCGGCTGCTCCGATTCCTAGATTAACTCGAGTTAATCTAGGAATCGGAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182496.1-1636s1c1
Sequence:CCGGGAACTGTGTGACCTCATCGAACTCGAGTTCGATGAGGTCACACAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182496
CCDC38 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 38
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182496.1-1687s1c1
Sequence:CCGGGAGAGGATGAAACAGAAAGAACTCGAGTTCTTTCTGTTTCATCCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182496.1-1461s1c1
Sequence:CCGGGCAATTAAAGTCCAAGCTCTTCTCGAGAAGAGCTTGGACTTTAATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182496.1-1201s1c1
Sequence:CCGGGATGATGAAATGGACGTTGATCTCGAGATCAACGTCCATTTCATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182496.1-324s1c1
Sequence:CCGGCAGAGATCTCTTTCTTGTCAACTCGAGTTGACAAGAAAGAGATCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182496.1-384s1c1
Sequence:CCGGGAACCGTAACATGAAAGTCTACTCGAGTAGACTTTCATGTTACGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182496.1-601s1c1
Sequence:CCGGGAGTATGCTTTGTCAACCAAACTCGAGTTTGGTTGACAAAGCATACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182496.1-1285s1c1
Sequence:CCGGGAGCAGAATCTTACTTTGTTTCTCGAGAAACAAAGTAAGATTCTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182496.1-1228s1c1
Sequence:CCGGCCAGCACTTTATTTCAAGGAACTCGAGTTCCTTGAAATAAAGTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182496.1-1423s1c1
Sequence:CCGGGCTAACTGTGTGAGAGAAGAACTCGAGTTCTTCTCTCACACAGTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182496.1-1751s1c1
Sequence:CCGGGACACCAACAGGAAAGGCTAACTCGAGTTAGCCTTTCCTGTTGGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182496.1-656s1c1
Sequence:CCGGCAATGAGGGAACGGCAACTAACTCGAGTTAGTTGCCGTTCCCTCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182496.1-512s1c1
Sequence:CCGGCTGCTCCGATTCCTAGATTAACTCGAGTTAATCTAGGAATCGGAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182496.1-1636s1c1
Sequence:CCGGGAACTGTGTGACCTCATCGAACTCGAGTTCGATGAGGTCACACAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)