EMAIL THIS PAGE TO A FRIEND

CCDC39

coiled-coil domain containing 39

56 Gene Product Result for
Synonyms: CILD14 FAP59
UniProtKB ID: Q9UFE4, B4E2H1
Gene ID:
Human(339829) Summary: The protein encoded by this gene is involved in the motility of cilia and flagella. The encoded protein is essential for the assembly of dynein regulatory and inner dynein arm complexes, which regulate ciliary beat. Defects in this gene are a cause of primary ciliary dyskinesia type 14 (CILD14). [provided by RefSeq, Jul 2011]
Mouse(51938) coiled-coil domain containing 39
Rat(310315) coiled-coil domain containing 39
domestic guinea pig(100713357) coiled-coil domain containing 39
naked mole-rat(101720210) coiled-coil domain containing 39
sheep(101105124) coiled-coil domain containing 39
Zebrafish(555319) coiled-coil domain containing 39
chicken(424969) coiled-coil domain containing 39
cow(534432) coiled-coil domain containing 39
domestic cat(101092836) coiled-coil domain containing 39
dog(488089) coiled-coil domain containing 39
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026222 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026222 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026222 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181426 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181426 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181426 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181426 Rosetta Predictions human pricing
XM_291028 Rosetta Predictions human pricing
NM_001107667 Rosetta Predictions rat pricing
NM_026222 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370036 predicted 2580
2 SASI_Hs02_00370037 predicted 2442
3 SASI_Hs02_00370038 predicted 704
4 SASI_Hs02_00370039 predicted 1747
5 SASI_Hs02_00370040 predicted 530
6 SASI_Hs02_00370041 predicted 250
7 SASI_Hs02_00370042 predicted 998
8 SASI_Hs02_00370043 predicted 1625
9 SASI_Hs02_00370044 predicted 227
10 SASI_Hs02_00370045 predicted 1023
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_291028 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288163 predicted 2087
2 SASI_Hs01_00288164 predicted 1463
3 SASI_Hs01_00288165 predicted 2509
4 SASI_Hs01_00288166 predicted 1294
5 SASI_Hs01_00288167 predicted 1002
6 SASI_Hs01_00288168 predicted 2583
7 SASI_Hs01_00288169 predicted 660
8 SASI_Hs01_00288170 predicted 1749
9 SASI_Hs01_00288171 predicted 1031
10 SASI_Hs01_00288172 predicted 990
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107667 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231085 predicted 815
2 SASI_Rn02_00231086 predicted 2028
3 SASI_Rn02_00231087 predicted 2266
4 SASI_Rn02_00231088 predicted 1902
5 SASI_Rn02_00231089 predicted 1896
6 SASI_Rn02_00231090 predicted 2321
7 SASI_Rn02_00231091 predicted 1372
8 SASI_Rn02_00231092 predicted 417
9 SASI_Rn02_00231093 predicted 766
10 SASI_Rn02_00231094 predicted 1281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026222 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134980 predicted 678
2 SASI_Mm01_00134982 predicted 249
3 SASI_Mm01_00134983 predicted 2586
4 SASI_Mm01_00134984 predicted 340
5 SASI_Mm01_00134985 predicted 2554
6 SASI_Mm01_00134986 predicted 2270
7 SASI_Mm01_00134987 predicted 2495
8 SASI_Mm01_00134988 predicted 441
9 SASI_Mm01_00134989 predicted 1162
10 SASI_Mm02_00329900 predicted 2401
11 SASI_Mm01_00134981 predicted 232
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026222
CCDC39 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 39
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200446    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026222.1-3201s1c1
Sequence:CCGGGCAGAGGGAAATAAGCAGGTTCTCGAGAACCTGCTTATTTCCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026222.1-2867s1c1
Sequence:CCGGCAGCTAGTAGTGGCAGTAATTCTCGAGAATTACTGCCACTACTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026222.1-2155s1c1
Sequence:CCGGGCTAAGATCAACAAAGCTGAACTCGAGTTCAGCTTTGTTGATCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026222.1-2404s1c1
Sequence:CCGGCACTTAGCAAATAATGCCAAACTCGAGTTTGGCATTATTTGCTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026222.1-394s1c1
Sequence:CCGGCGAGTCAAGAATGAGACCCAACTCGAGTTGGGTCTCATTCTTGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026222.1-2589s1c1
Sequence:CCGGGCTCCGTGAGATCATACAGTTCTCGAGAACTGTATGATCTCACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026222.1-3190s1c1
Sequence:CCGGCATGTGACAAAGCAGAGGGAACTCGAGTTCCCTCTGCTTTGTCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026222.1-1560s1c1
Sequence:CCGGCCTTGAACTTAAGAAGACAATCTCGAGATTGTCTTCTTAAGTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026222.1-898s1c1
Sequence:CCGGGAGAAGATCAAGTTTCTGGAACTCGAGTTCCAGAAACTTGATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177337    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026222.1-3390s1c1
Sequence:CCGGGAACAACTGTATTCTTCAGATCTCGAGATCTGAAGAATACAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026222.2-254s21c1
Sequence:CCGGTGACTATGAAGAACGAATTAACTCGAGTTAATTCGTTCTTCATAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026222.2-2494s21c1
Sequence:CCGGAGCCGAAATTGCAGCGAATAACTCGAGTTATTCGCTGCAATTTCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026222.2-1500s21c1
Sequence:CCGGGAACGCAGAATGTCACGATTACTCGAGTAATCGTGACATTCTGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026222.2-709s21c1
Sequence:CCGGAGACGCTAAGTGCGCAGTTAGCTCGAGCTAACTGCGCACTTAGCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026222
CCDC39 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 39
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200446    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026222.1-3201s1c1
Sequence:CCGGGCAGAGGGAAATAAGCAGGTTCTCGAGAACCTGCTTATTTCCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026222.1-2867s1c1
Sequence:CCGGCAGCTAGTAGTGGCAGTAATTCTCGAGAATTACTGCCACTACTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026222.1-2155s1c1
Sequence:CCGGGCTAAGATCAACAAAGCTGAACTCGAGTTCAGCTTTGTTGATCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026222.1-2404s1c1
Sequence:CCGGCACTTAGCAAATAATGCCAAACTCGAGTTTGGCATTATTTGCTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026222.1-394s1c1
Sequence:CCGGCGAGTCAAGAATGAGACCCAACTCGAGTTGGGTCTCATTCTTGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026222.1-2589s1c1
Sequence:CCGGGCTCCGTGAGATCATACAGTTCTCGAGAACTGTATGATCTCACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026222.1-3190s1c1
Sequence:CCGGCATGTGACAAAGCAGAGGGAACTCGAGTTCCCTCTGCTTTGTCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026222.1-1560s1c1
Sequence:CCGGCCTTGAACTTAAGAAGACAATCTCGAGATTGTCTTCTTAAGTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026222.1-898s1c1
Sequence:CCGGGAGAAGATCAAGTTTCTGGAACTCGAGTTCCAGAAACTTGATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177337    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026222.1-3390s1c1
Sequence:CCGGGAACAACTGTATTCTTCAGATCTCGAGATCTGAAGAATACAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026222.2-254s21c1
Sequence:CCGGTGACTATGAAGAACGAATTAACTCGAGTTAATTCGTTCTTCATAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026222.2-2494s21c1
Sequence:CCGGAGCCGAAATTGCAGCGAATAACTCGAGTTATTCGCTGCAATTTCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026222.2-1500s21c1
Sequence:CCGGGAACGCAGAATGTCACGATTACTCGAGTAATCGTGACATTCTGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026222.2-709s21c1
Sequence:CCGGAGACGCTAAGTGCGCAGTTAGCTCGAGCTAACTGCGCACTTAGCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026222
CCDC39 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 39
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200446    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026222.1-3201s1c1
Sequence:CCGGGCAGAGGGAAATAAGCAGGTTCTCGAGAACCTGCTTATTTCCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026222.1-2867s1c1
Sequence:CCGGCAGCTAGTAGTGGCAGTAATTCTCGAGAATTACTGCCACTACTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026222.1-2155s1c1
Sequence:CCGGGCTAAGATCAACAAAGCTGAACTCGAGTTCAGCTTTGTTGATCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026222.1-2404s1c1
Sequence:CCGGCACTTAGCAAATAATGCCAAACTCGAGTTTGGCATTATTTGCTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026222.1-394s1c1
Sequence:CCGGCGAGTCAAGAATGAGACCCAACTCGAGTTGGGTCTCATTCTTGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026222.1-2589s1c1
Sequence:CCGGGCTCCGTGAGATCATACAGTTCTCGAGAACTGTATGATCTCACGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026222.1-3190s1c1
Sequence:CCGGCATGTGACAAAGCAGAGGGAACTCGAGTTCCCTCTGCTTTGTCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026222.1-1560s1c1
Sequence:CCGGCCTTGAACTTAAGAAGACAATCTCGAGATTGTCTTCTTAAGTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026222.1-898s1c1
Sequence:CCGGGAGAAGATCAAGTTTCTGGAACTCGAGTTCCAGAAACTTGATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177337    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026222.1-3390s1c1
Sequence:CCGGGAACAACTGTATTCTTCAGATCTCGAGATCTGAAGAATACAGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026222.2-254s21c1
Sequence:CCGGTGACTATGAAGAACGAATTAACTCGAGTTAATTCGTTCTTCATAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026222.2-2494s21c1
Sequence:CCGGAGCCGAAATTGCAGCGAATAACTCGAGTTATTCGCTGCAATTTCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026222.2-1500s21c1
Sequence:CCGGGAACGCAGAATGTCACGATTACTCGAGTAATCGTGACATTCTGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026222.2-709s21c1
Sequence:CCGGAGACGCTAAGTGCGCAGTTAGCTCGAGCTAACTGCGCACTTAGCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181426
CCDC39 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 39
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181426.1-2894s21c1
Sequence:CCGGGCTAGTAGTAGCTCTAGTAATCTCGAGATTACTAGAGCTACTACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181426.1-253s21c1
Sequence:CCGGTGAGTATGAAGAGCGAATTAACTCGAGTTAATTCGCTCTTCATACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181426.1-1997s21c1
Sequence:CCGGTTTCGCGAGCGGCTAAGTAAACTCGAGTTTACTTAGCCGCTCGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181426.1-1501s21c1
Sequence:CCGGACGGAGAATGTCACGGTTAAACTCGAGTTTAACCGTGACATTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181426.1-3583s21c1
Sequence:CCGGCCTTGAAATAAACGCATTAAACTCGAGTTTAATGCGTTTATTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181426
CCDC39 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 39
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181426.1-2894s21c1
Sequence:CCGGGCTAGTAGTAGCTCTAGTAATCTCGAGATTACTAGAGCTACTACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181426.1-253s21c1
Sequence:CCGGTGAGTATGAAGAGCGAATTAACTCGAGTTAATTCGCTCTTCATACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181426.1-1997s21c1
Sequence:CCGGTTTCGCGAGCGGCTAAGTAAACTCGAGTTTACTTAGCCGCTCGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181426.1-1501s21c1
Sequence:CCGGACGGAGAATGTCACGGTTAAACTCGAGTTTAACCGTGACATTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181426.1-3583s21c1
Sequence:CCGGCCTTGAAATAAACGCATTAAACTCGAGTTTAATGCGTTTATTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181426
CCDC39 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 39
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181426.1-2894s21c1
Sequence:CCGGGCTAGTAGTAGCTCTAGTAATCTCGAGATTACTAGAGCTACTACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181426.1-253s21c1
Sequence:CCGGTGAGTATGAAGAGCGAATTAACTCGAGTTAATTCGCTCTTCATACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181426.1-1997s21c1
Sequence:CCGGTTTCGCGAGCGGCTAAGTAAACTCGAGTTTACTTAGCCGCTCGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181426.1-1501s21c1
Sequence:CCGGACGGAGAATGTCACGGTTAAACTCGAGTTTAACCGTGACATTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181426.1-3583s21c1
Sequence:CCGGCCTTGAAATAAACGCATTAAACTCGAGTTTAATGCGTTTATTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks