EMAIL THIS PAGE TO A FRIEND

CCDC3

coiled-coil domain containing 3

56 Gene Product Result for
UniProtKB ID: Q9BQI4, Q5VYV8
Gene ID:
Mouse(74186) coiled-coil domain containing 3
Rat(498795) coiled-coil domain containing 3
domestic guinea pig(100724467) coiled-coil domain containing 3
naked mole-rat(101725226) coiled-coil domain containing 3
sheep(101109471) coiled-coil domain containing 3
Zebrafish(560952) coiled-coil domain containing 3
dog(607593) coiled-coil domain containing 3
cow(509875) coiled-coil domain containing 3
domestic cat(101097494) coiled-coil domain containing 3
chicken(769832) coiled-coil domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031455 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031455 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031455 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028804 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028804 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028804 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031455 Rosetta Predictions human pricing
XM_001071191 Rosetta Predictions rat pricing
XM_574081 Rosetta Predictions rat pricing
NM_028804 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220932 predicted 1060
2 SASI_Hs02_00358870 predicted 1285
3 SASI_Hs01_00220933 predicted 1012
4 SASI_Hs01_00220934 predicted 518
5 SASI_Hs01_00220935 predicted 995
6 SASI_Hs01_00220936 predicted 638
7 SASI_Hs01_00220937 predicted 1350
8 SASI_Hs01_00220938 predicted 976
9 SASI_Hs01_00220939 predicted 967
10 SASI_Hs01_00220940 predicted 969
11 SASI_Hs01_00220941 predicted 1347
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071191 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334137 predicted 1286
2 SASI_Rn02_00334138 predicted 1368
3 SASI_Rn02_00334139 predicted 1336
4 SASI_Rn02_00334140 predicted 1090
5 SASI_Rn02_00334141 predicted 1046
6 SASI_Rn02_00334142 predicted 1301
7 SASI_Rn02_00334143 predicted 628
8 SASI_Rn02_00334144 predicted 664
9 SASI_Rn02_00334145 predicted 1060
10 SASI_Rn02_00334146 predicted 1247
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401339 predicted 513
2 SASI_Rn02_00401340 predicted 500
3 SASI_Rn02_00401341 predicted 604
4 SASI_Rn02_00401342 predicted 448
5 SASI_Rn02_00401343 predicted 556
6 SASI_Rn02_00401344 predicted 471
7 SASI_Rn02_00401345 predicted 503
8 SASI_Rn02_00401346 predicted 454
9 SASI_Rn02_00401347 predicted 582
10 SASI_Rn02_00401348 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028804 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109626 predicted 1067
2 SASI_Mm01_00109627 predicted 1083
3 SASI_Mm01_00109628 predicted 1092
4 SASI_Mm01_00109630 predicted 1285
5 SASI_Mm01_00109632 predicted 1232
6 SASI_Mm01_00109633 predicted 1312
7 SASI_Mm01_00109634 predicted 1042
8 SASI_Mm02_00334416 predicted 1144
9 SASI_Mm02_00334417 predicted 1070
10 SASI_Mm02_00334418 predicted 1086
11 SASI_Mm01_00109629 predicted 1042
12 SASI_Mm01_00109631 predicted 1436
13 SASI_Mm01_00109635 predicted 1305
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031455
VALIDATED
CCDC3 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031455.3-1009s21c1
Sequence:CCGGTTTCGTACATGCAGCTATTTCCTCGAGGAAATAGCTGCATGTACGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031455.3-976s21c1
Sequence:CCGGGCCAATCCTGGCGGTAATTGACTCGAGTCAATTACCGCCAGGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031455.3-477s21c1
Sequence:CCGGGTCCAGGACTACTCCTATTTCCTCGAGGAAATAGGAGTAGTCCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031455.2-797s1c1
Sequence:CCGGGAAGAAGGTCAAGAGGTCCTTCTCGAGAAGGACCTCTTGACCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031455.2-2510s1c1
Sequence:CCGGCCACCACTTCATTAGCTGTATCTCGAGATACAGCTAATGAAGTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031455.2-534s1c1
Sequence:CCGGCCTCACGGAGTCAATTTCCAACTCGAGTTGGAAATTGACTCCGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031455.2-860s1c1
Sequence:CCGGCCAGAAACTCAGTGAGAAGCTCTCGAGAGCTTCTCACTGAGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031455.2-1060s1c1
Sequence:CCGGCGCATTTGGTAGAGTCTAAATCTCGAGATTTAGACTCTACCAAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031455.2-2123s1c1
Sequence:CCGGGCTGTGTGATTAAGAAGTCAACTCGAGTTGACTTCTTAATCACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031455.2-856s1c1
Sequence:CCGGCGAACCAGAAACTCAGTGAGACTCGAGTCTCACTGAGTTTCTGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031455.2-646s1c1
Sequence:CCGGCTTTCTCCAGTGACTGGGAAACTCGAGTTTCCCAGTCACTGGAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031455
VALIDATED
CCDC3 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031455.3-1009s21c1
Sequence:CCGGTTTCGTACATGCAGCTATTTCCTCGAGGAAATAGCTGCATGTACGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031455.3-976s21c1
Sequence:CCGGGCCAATCCTGGCGGTAATTGACTCGAGTCAATTACCGCCAGGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031455.3-477s21c1
Sequence:CCGGGTCCAGGACTACTCCTATTTCCTCGAGGAAATAGGAGTAGTCCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031455.2-797s1c1
Sequence:CCGGGAAGAAGGTCAAGAGGTCCTTCTCGAGAAGGACCTCTTGACCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031455.2-2510s1c1
Sequence:CCGGCCACCACTTCATTAGCTGTATCTCGAGATACAGCTAATGAAGTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031455.2-534s1c1
Sequence:CCGGCCTCACGGAGTCAATTTCCAACTCGAGTTGGAAATTGACTCCGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031455.2-860s1c1
Sequence:CCGGCCAGAAACTCAGTGAGAAGCTCTCGAGAGCTTCTCACTGAGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031455.2-1060s1c1
Sequence:CCGGCGCATTTGGTAGAGTCTAAATCTCGAGATTTAGACTCTACCAAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031455.2-2123s1c1
Sequence:CCGGGCTGTGTGATTAAGAAGTCAACTCGAGTTGACTTCTTAATCACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031455.2-856s1c1
Sequence:CCGGCGAACCAGAAACTCAGTGAGACTCGAGTCTCACTGAGTTTCTGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031455.2-646s1c1
Sequence:CCGGCTTTCTCCAGTGACTGGGAAACTCGAGTTTCCCAGTCACTGGAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031455
VALIDATED
CCDC3 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031455.3-1009s21c1
Sequence:CCGGTTTCGTACATGCAGCTATTTCCTCGAGGAAATAGCTGCATGTACGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031455.3-976s21c1
Sequence:CCGGGCCAATCCTGGCGGTAATTGACTCGAGTCAATTACCGCCAGGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031455.3-477s21c1
Sequence:CCGGGTCCAGGACTACTCCTATTTCCTCGAGGAAATAGGAGTAGTCCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031455.2-797s1c1
Sequence:CCGGGAAGAAGGTCAAGAGGTCCTTCTCGAGAAGGACCTCTTGACCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031455.2-2510s1c1
Sequence:CCGGCCACCACTTCATTAGCTGTATCTCGAGATACAGCTAATGAAGTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031455.2-534s1c1
Sequence:CCGGCCTCACGGAGTCAATTTCCAACTCGAGTTGGAAATTGACTCCGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031455.2-860s1c1
Sequence:CCGGCCAGAAACTCAGTGAGAAGCTCTCGAGAGCTTCTCACTGAGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133751    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031455.2-1060s1c1
Sequence:CCGGCGCATTTGGTAGAGTCTAAATCTCGAGATTTAGACTCTACCAAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031455.2-2123s1c1
Sequence:CCGGGCTGTGTGATTAAGAAGTCAACTCGAGTTGACTTCTTAATCACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031455.2-856s1c1
Sequence:CCGGCGAACCAGAAACTCAGTGAGACTCGAGTCTCACTGAGTTTCTGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031455.2-646s1c1
Sequence:CCGGCTTTCTCCAGTGACTGGGAAACTCGAGTTTCCCAGTCACTGGAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028804
CCDC3 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028804.1-274s21c1
Sequence:CCGGTAGCCGAGACCATCGTGTATGCTCGAGCATACACGATGGTCTCGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028804.1-527s21c1
Sequence:CCGGTGTAAGGATGGATGAGAATTACTCGAGTAATTCTCATCCATCCTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028804.1-554s21c1
Sequence:CCGGCTTGCCACACGGAGTCAATTTCTCGAGAAATTGACTCCGTGTGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028804.1-500s1c1
Sequence:CCGGGGTCCAGGACTACTCTTATTTCTCGAGAAATAAGAGTAGTCCTGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028804.1-1095s21c1
Sequence:CCGGTAGAGTCTAACTGGGTAAATTCTCGAGAATTTACCCAGTTAGACTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028804.1-499s21c1
Sequence:CCGGTGGTCCAGGACTACTCTTATTCTCGAGAATAAGAGTAGTCCTGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028804.1-821s1c1
Sequence:CCGGCAAGAAGGTCAAGAGGTCTCTCTCGAGAGAGACCTCTTGACCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190840    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028804.1-2440s1c1
Sequence:CCGGGCCTCTTTAAGCAGTGCTATTCTCGAGAATAGCACTGCTTAAAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028804
CCDC3 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028804.1-274s21c1
Sequence:CCGGTAGCCGAGACCATCGTGTATGCTCGAGCATACACGATGGTCTCGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028804.1-527s21c1
Sequence:CCGGTGTAAGGATGGATGAGAATTACTCGAGTAATTCTCATCCATCCTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028804.1-554s21c1
Sequence:CCGGCTTGCCACACGGAGTCAATTTCTCGAGAAATTGACTCCGTGTGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028804.1-500s1c1
Sequence:CCGGGGTCCAGGACTACTCTTATTTCTCGAGAAATAAGAGTAGTCCTGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028804.1-1095s21c1
Sequence:CCGGTAGAGTCTAACTGGGTAAATTCTCGAGAATTTACCCAGTTAGACTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028804.1-499s21c1
Sequence:CCGGTGGTCCAGGACTACTCTTATTCTCGAGAATAAGAGTAGTCCTGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028804.1-821s1c1
Sequence:CCGGCAAGAAGGTCAAGAGGTCTCTCTCGAGAGAGACCTCTTGACCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190840    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028804.1-2440s1c1
Sequence:CCGGGCCTCTTTAAGCAGTGCTATTCTCGAGAATAGCACTGCTTAAAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028804
CCDC3 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028804.1-274s21c1
Sequence:CCGGTAGCCGAGACCATCGTGTATGCTCGAGCATACACGATGGTCTCGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028804.1-527s21c1
Sequence:CCGGTGTAAGGATGGATGAGAATTACTCGAGTAATTCTCATCCATCCTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028804.1-554s21c1
Sequence:CCGGCTTGCCACACGGAGTCAATTTCTCGAGAAATTGACTCCGTGTGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028804.1-500s1c1
Sequence:CCGGGGTCCAGGACTACTCTTATTTCTCGAGAAATAAGAGTAGTCCTGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028804.1-1095s21c1
Sequence:CCGGTAGAGTCTAACTGGGTAAATTCTCGAGAATTTACCCAGTTAGACTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028804.1-499s21c1
Sequence:CCGGTGGTCCAGGACTACTCTTATTCTCGAGAATAAGAGTAGTCCTGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028804.1-821s1c1
Sequence:CCGGCAAGAAGGTCAAGAGGTCTCTCTCGAGAGAGACCTCTTGACCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190840    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028804.1-2440s1c1
Sequence:CCGGGCCTCTTTAAGCAGTGCTATTCTCGAGAATAGCACTGCTTAAAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks